ID: 942419385

View in Genome Browser
Species Human (GRCh38)
Location 2:175792395-175792417
Sequence CAGACCAAGGACTAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942419385_942419387 18 Left 942419385 2:175792395-175792417 CCAGAACACTAGTCCTTGGTCTG No data
Right 942419387 2:175792436-175792458 TAGCAAGTGCAATGACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942419385 Original CRISPR CAGACCAAGGACTAGTGTTC TGG (reversed) Intergenic
No off target data available for this crispr