ID: 942422107

View in Genome Browser
Species Human (GRCh38)
Location 2:175818966-175818988
Sequence AAATTATGAAACACATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942422107_942422112 24 Left 942422107 2:175818966-175818988 CCCTCTTATGTGTTTCATAATTT No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data
942422107_942422110 -6 Left 942422107 2:175818966-175818988 CCCTCTTATGTGTTTCATAATTT No data
Right 942422110 2:175818983-175819005 TAATTTTTTCCTCTGGTTTTAGG No data
942422107_942422113 25 Left 942422107 2:175818966-175818988 CCCTCTTATGTGTTTCATAATTT No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942422107 Original CRISPR AAATTATGAAACACATAAGA GGG (reversed) Intergenic