ID: 942422108

View in Genome Browser
Species Human (GRCh38)
Location 2:175818967-175818989
Sequence AAAATTATGAAACACATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942422108_942422113 24 Left 942422108 2:175818967-175818989 CCTCTTATGTGTTTCATAATTTT No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data
942422108_942422112 23 Left 942422108 2:175818967-175818989 CCTCTTATGTGTTTCATAATTTT No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data
942422108_942422110 -7 Left 942422108 2:175818967-175818989 CCTCTTATGTGTTTCATAATTTT No data
Right 942422110 2:175818983-175819005 TAATTTTTTCCTCTGGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942422108 Original CRISPR AAAATTATGAAACACATAAG AGG (reversed) Intergenic
No off target data available for this crispr