ID: 942422111

View in Genome Browser
Species Human (GRCh38)
Location 2:175818992-175819014
Sequence GCAAGCAATCCTAAAACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942422111_942422113 -1 Left 942422111 2:175818992-175819014 CCTCTGGTTTTAGGATTGCTTGC No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data
942422111_942422112 -2 Left 942422111 2:175818992-175819014 CCTCTGGTTTTAGGATTGCTTGC No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942422111 Original CRISPR GCAAGCAATCCTAAAACCAG AGG (reversed) Intergenic