ID: 942422112

View in Genome Browser
Species Human (GRCh38)
Location 2:175819013-175819035
Sequence GCAAAATCCTTAGATAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942422107_942422112 24 Left 942422107 2:175818966-175818988 CCCTCTTATGTGTTTCATAATTT No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data
942422108_942422112 23 Left 942422108 2:175818967-175818989 CCTCTTATGTGTTTCATAATTTT No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data
942422111_942422112 -2 Left 942422111 2:175818992-175819014 CCTCTGGTTTTAGGATTGCTTGC No data
Right 942422112 2:175819013-175819035 GCAAAATCCTTAGATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942422112 Original CRISPR GCAAAATCCTTAGATAAAAA AGG Intergenic