ID: 942422113

View in Genome Browser
Species Human (GRCh38)
Location 2:175819014-175819036
Sequence CAAAATCCTTAGATAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942422108_942422113 24 Left 942422108 2:175818967-175818989 CCTCTTATGTGTTTCATAATTTT No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data
942422107_942422113 25 Left 942422107 2:175818966-175818988 CCCTCTTATGTGTTTCATAATTT No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data
942422111_942422113 -1 Left 942422111 2:175818992-175819014 CCTCTGGTTTTAGGATTGCTTGC No data
Right 942422113 2:175819014-175819036 CAAAATCCTTAGATAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942422113 Original CRISPR CAAAATCCTTAGATAAAAAA GGG Intergenic
No off target data available for this crispr