ID: 942428134

View in Genome Browser
Species Human (GRCh38)
Location 2:175880757-175880779
Sequence TAGATCATGCAGGACCTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942428131_942428134 1 Left 942428131 2:175880733-175880755 CCTTGGTTGGATAATGATGTTGG No data
Right 942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942428134 Original CRISPR TAGATCATGCAGGACCTTCA CGG Intergenic
No off target data available for this crispr