ID: 942431701

View in Genome Browser
Species Human (GRCh38)
Location 2:175918478-175918500
Sequence TCTATATGCTGTCTGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942431701_942431706 23 Left 942431701 2:175918478-175918500 CCAGCACACAGACAGCATATAGA No data
Right 942431706 2:175918524-175918546 AATGAATAAATGAAAACACTGGG No data
942431701_942431703 -4 Left 942431701 2:175918478-175918500 CCAGCACACAGACAGCATATAGA No data
Right 942431703 2:175918497-175918519 TAGAAGGCATTCCTTAAAAGAGG No data
942431701_942431705 22 Left 942431701 2:175918478-175918500 CCAGCACACAGACAGCATATAGA No data
Right 942431705 2:175918523-175918545 GAATGAATAAATGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942431701 Original CRISPR TCTATATGCTGTCTGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr