ID: 942432456

View in Genome Browser
Species Human (GRCh38)
Location 2:175927100-175927122
Sequence TACAGGACGTTGAGAGCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942432456 Original CRISPR TACAGGACGTTGAGAGCAAG AGG Exonic
900208133 1:1440169-1440191 TCCTGGACGTTGATAGGAAGCGG + Exonic
908057128 1:60299773-60299795 GAGAGGAGGCTGAGAGCAAGGGG - Intergenic
909201826 1:72699205-72699227 TACAGTTCTTTGAGAGCAAAAGG - Intergenic
909221984 1:72976409-72976431 TCCAGGACATTGGAAGCAAGCGG + Intergenic
914828724 1:151155148-151155170 TACAGGACGTTCTCAGGAAGTGG - Intergenic
920442234 1:205988996-205989018 GACAGGACGTGGAGAGGATGAGG - Intronic
922157998 1:223054894-223054916 GACAGGATGGTGAGAGCATGTGG - Intergenic
923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG + Intronic
1063387125 10:5623077-5623099 TACAGGTCGTTCAGAGCTGGTGG - Intergenic
1064211961 10:13367154-13367176 TACAGGAATTTCAGAGCAGGAGG - Intergenic
1074481702 10:113828160-113828182 TACGGGACCCTGAGAGCGAGTGG - Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1075983377 10:126761201-126761223 GTCAGGAGGTTGAGGGCAAGAGG - Intergenic
1077101896 11:826121-826143 GACAGGACCTTGAGACCAAGGGG - Intergenic
1083484913 11:62977180-62977202 TGCAGGACCTGGAGAGCAGGTGG - Exonic
1091630581 12:2157486-2157508 GACAGCACTCTGAGAGCAAGTGG - Intronic
1094865968 12:34530355-34530377 GACAGGGCTTTGAGAGCAACTGG - Intergenic
1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG + Intergenic
1099213599 12:79825106-79825128 TACAGGTCATTAAGAGAAAGTGG + Intronic
1102783719 12:115586884-115586906 AACAGGAGGAAGAGAGCAAGGGG - Intergenic
1110278955 13:73670478-73670500 GACAACACTTTGAGAGCAAGAGG - Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1118239305 14:64040378-64040400 TACAGTACTTTGAGAACAAAAGG + Intronic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1129000973 15:72333582-72333604 TCCAGGAGTTTGAGAGCAACTGG - Intronic
1130912759 15:88282400-88282422 TACAGGACTTTAAGACCCAGTGG + Intergenic
1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG + Intergenic
1133693128 16:8235491-8235513 TTCAGCACTGTGAGAGCAAGAGG + Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142610442 17:1106873-1106895 CACAAGGCGTTCAGAGCAAGGGG - Intronic
1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG + Intronic
1143579623 17:7817931-7817953 TTCAGGCCCTAGAGAGCAAGGGG - Exonic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1143880027 17:10022938-10022960 TACAGGAGCTGGAGAGCCAGTGG + Intronic
1150485201 17:65538345-65538367 TACAGGACGTGGAAAGGAAAGGG + Intronic
1153846305 18:9052643-9052665 GACAGGAGGTTGACAACAAGGGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1163083338 19:14959668-14959690 TTCAGGAAGGTGAGAGCATGGGG - Intronic
1163340369 19:16702459-16702481 TACAGGACTTTGGGAGCCACCGG - Intergenic
1165758600 19:38308145-38308167 AACAGGGCGATGTGAGCAAGAGG + Intronic
924981748 2:228991-229013 TAGAGGACTTTCAGAACAAGAGG - Intronic
931071868 2:58660539-58660561 TACAGCACTTTGAGAGGCAGAGG + Intergenic
931681032 2:64750389-64750411 TACAGGACGGTGAGTTCGAGGGG + Intronic
934551128 2:95262514-95262536 TAAAGGAAGTTGAGACCAGGAGG + Intergenic
934658903 2:96132723-96132745 TGCAGGGTGATGAGAGCAAGTGG + Intronic
935227045 2:101061767-101061789 GGCAGGAAGTGGAGAGCAAGAGG - Intronic
935612244 2:105037820-105037842 TTCAGGACGTGAAGAGAAAGAGG + Intergenic
937436283 2:121884557-121884579 AACAGGATGCAGAGAGCAAGTGG + Intergenic
938481271 2:131663656-131663678 TCCAGGACGTTGAGAGGCTGAGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG + Intronic
946449949 2:219771346-219771368 CCCAGCACTTTGAGAGCAAGAGG - Intergenic
946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG + Intergenic
1168802291 20:651400-651422 GACAGGACGTTAAAAGCCAGTGG + Intronic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1173070158 20:39756457-39756479 TACAGGCCAAAGAGAGCAAGGGG + Intergenic
1173581268 20:44148539-44148561 TCCAGGACGTTGTCAGCAGGTGG - Intronic
1173743057 20:45416172-45416194 AACAGGACGAGCAGAGCAAGCGG - Exonic
1175387889 20:58608843-58608865 GAGAGGACGTTGAGAGCACGGGG - Intergenic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1178871678 21:36382481-36382503 TACAGGAGATTGAGAACAACGGG - Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
950106450 3:10391979-10392001 TGGAGGAGGTTGTGAGCAAGAGG - Intronic
957682678 3:83457918-83457940 TAGAGGAAGTTGAGAAAAAGTGG - Intergenic
965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG + Intronic
971225871 4:24751108-24751130 TACAAGAAGTTTAGAGGAAGGGG - Intergenic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
977299181 4:95248469-95248491 GACAGGAAGTTGAGACCACGGGG - Intronic
978023886 4:103848431-103848453 GACAGGGCTTTGAGAGCAACCGG + Intergenic
980749318 4:137068642-137068664 TAAATGACATTGAGACCAAGGGG - Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
987394972 5:17414274-17414296 CACAGGACACTGAGAGCGAGAGG - Intergenic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG + Intergenic
992496776 5:77301421-77301443 TACATGAAGTTGGGAGAAAGTGG - Intronic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997477535 5:134153609-134153631 TAAAGGGTGCTGAGAGCAAGAGG + Exonic
998903971 5:146883811-146883833 TACAACACTTTGAGGGCAAGAGG - Intronic
999052852 5:148542687-148542709 TACAGCATGTTCAGAGAAAGGGG + Intronic
999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG + Intergenic
1005067475 6:21832563-21832585 TACAAGACCATGAGAGCAAGAGG + Intergenic
1007525678 6:42490504-42490526 TACTGGAGGTTGGGAGCAATGGG + Intergenic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1010102977 6:72131704-72131726 GACAGGGCTTTGAGAGCAACTGG + Intronic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1026850520 7:73720422-73720444 TACTGGATGATGGGAGCAAGGGG - Intergenic
1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG + Intergenic
1033282854 7:140018019-140018041 CACAGGATGTTGAGAGGTAGAGG - Intronic
1033343917 7:140512679-140512701 CAGAGGACGAGGAGAGCAAGAGG + Intergenic
1035822632 8:2610726-2610748 ACCAGGAGGTAGAGAGCAAGTGG - Intergenic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1044052669 8:87527717-87527739 TACGGGATTTTAAGAGCAAGGGG - Intronic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1047798533 8:128284272-128284294 TACCGGATGGTGAGATCAAGGGG + Intergenic
1049141031 8:140954278-140954300 TTCAGGAGTTTGAGACCAAGTGG - Intronic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1054925642 9:70586038-70586060 TTCAGGAAGATGAGAGCAGGAGG - Intronic
1054951780 9:70859852-70859874 TACAGGAGGTTGACTGAAAGTGG + Intronic
1056396367 9:86185169-86185191 CAAAGGTGGTTGAGAGCAAGTGG + Intergenic
1185768688 X:2748128-2748150 CCCAGGACTTTGAGAGCCAGAGG - Intergenic
1193186709 X:78521979-78522001 TGCAGGAGGCAGAGAGCAAGAGG + Intergenic
1196889835 X:120281309-120281331 CCCAGAACGTTGAGAGCAAGGGG - Intronic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic