ID: 942437416

View in Genome Browser
Species Human (GRCh38)
Location 2:175995461-175995483
Sequence CTATTCAAGGCTATAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942437416 Original CRISPR CTATTCAAGGCTATAATCAA AGG Intronic
905478414 1:38244965-38244987 CTACTCAAGGCTGTACCCAAAGG - Intergenic
906401902 1:45510536-45510558 CTAATCAAGGCTAGAACCAAGGG + Exonic
919400116 1:197103728-197103750 CTTTTAGAGGCTATAATAAAAGG - Exonic
919751153 1:201039139-201039161 ATATTCAAGGCAATAAACAGGGG + Intergenic
922589880 1:226767037-226767059 GTATTCAAATGTATAATCAAGGG + Intergenic
924258332 1:242204323-242204345 CTGCTCAAGGTTATTATCAATGG - Intronic
1063714139 10:8510599-8510621 CTACTTAAGGTTATAATTAAAGG - Intergenic
1068831729 10:61503932-61503954 ATATTCAAGGCTAGAATTAAGGG + Intergenic
1074240507 10:111634310-111634332 CTATCAAAGGCTATAAACGAAGG + Intergenic
1079439597 11:20497553-20497575 TTAATCAAGGCTAACATCAAAGG - Intronic
1085361748 11:75894556-75894578 CTAGTAAAGGCTAAAATCAGAGG + Intronic
1088002483 11:104899193-104899215 TTATCCATGGCTCTAATCAATGG + Intergenic
1089023694 11:115245019-115245041 CTAGTCAAGACTATAATAAAAGG + Intronic
1090624382 11:128593300-128593322 CTATTGACTGCTATTATCAATGG + Intergenic
1092589798 12:9942063-9942085 GTAGTCAAGGCTTTAATGAAGGG - Intergenic
1095582612 12:43817373-43817395 CTTTTCAATCATATAATCAAGGG - Intergenic
1099172723 12:79384711-79384733 CTATTCAAGCCTTGAAACAATGG - Intronic
1103420224 12:120774773-120774795 CTTTTCAAGGCTAAAGTGAAGGG + Intronic
1105947903 13:25205093-25205115 TGATTCAAGGCCAAAATCAAAGG + Intergenic
1106977682 13:35240717-35240739 GTATTAAAAACTATAATCAAAGG + Intronic
1107895991 13:44964464-44964486 CTCTTTAAGGCTGTAAGCAAGGG - Intronic
1109185694 13:59265018-59265040 ATATTCATGGAAATAATCAAGGG + Intergenic
1110984389 13:81945613-81945635 CCATTAAAGGCTAAAAGCAAAGG - Intergenic
1111739425 13:92184391-92184413 CTATTCAAAGATATATCCAATGG - Intronic
1112068380 13:95819191-95819213 ATATTCAAGAGTATAATAAAGGG - Intronic
1113147476 13:107224079-107224101 TTATTGAAAACTATAATCAATGG + Intronic
1115198689 14:30829888-30829910 CTATACAAGGCAATATTCACTGG - Intergenic
1121033452 14:90679269-90679291 CCATTCAAAGTTTTAATCAAAGG + Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1127532249 15:59855070-59855092 GTGATCAAGGCTATAAGCAATGG + Intergenic
1130450783 15:84049748-84049770 CTATACAAAACTATAATCTAAGG - Intergenic
1131687735 15:94788673-94788695 CTAATCACGGCTAGAAGCAAAGG + Intergenic
1134557115 16:15174848-15174870 CTATCCAATGCTAAATTCAATGG + Intergenic
1138743280 16:59334921-59334943 TTGTTCATTGCTATAATCAAAGG - Intergenic
1143999177 17:11036800-11036822 CTATTCTGGGCCATAATCAGAGG - Intergenic
1145856607 17:28164934-28164956 TTCTTCAAGGCTATAATGAAGGG - Intronic
1146523888 17:33549442-33549464 CTTTTCAAAGCTATAATCATGGG + Intronic
1148792743 17:50182856-50182878 TTATTGAAGGCCATAATGAACGG + Intergenic
1152211620 17:79005406-79005428 CTGAGCAAGGCTATAATGAAGGG + Intronic
1156046913 18:32887366-32887388 TTATTCAAGGTTATAAACAGAGG + Intergenic
1158907188 18:62025105-62025127 CTATTGAAGGCTATAAAAATAGG + Intergenic
1159427366 18:68307321-68307343 TTTTTTAAGGCTATAATAAAGGG - Intergenic
1163932270 19:20407239-20407261 CTATTCAAGTCTATATTTCAGGG - Intergenic
925899943 2:8501989-8502011 CTACTGAAGCCTACAATCAATGG + Intergenic
930039656 2:47110997-47111019 CTATACAAAGATATGATCAAGGG - Intronic
935950671 2:108325704-108325726 CTATTCATGGATATTATAAAAGG - Intergenic
935953937 2:108355722-108355744 CTTTTCAATGCTATAATAAATGG + Intergenic
936401993 2:112171784-112171806 CTATTCTAGGCTTTATTAAATGG + Intronic
938427613 2:131204408-131204430 ATATTCAAGGTTATTATTAACGG - Intronic
938468546 2:131538430-131538452 ATATTCAAGGTTATTATTAATGG - Intergenic
940079536 2:149784659-149784681 CTATTCAAGTCTTTACTCAATGG + Intergenic
940948201 2:159643084-159643106 ATATTCAAGTCTATCATAAATGG - Intergenic
942437416 2:175995461-175995483 CTATTCAAGGCTATAATCAAAGG + Intronic
945459999 2:210095271-210095293 ATTTTAAAGGCTATAATAAAAGG - Intronic
947183693 2:227435439-227435461 ATATTCAATGGTATGATCAATGG - Intergenic
1169824802 20:9755733-9755755 CAAATCAAGGCTCTAATGAAAGG + Intronic
1174600097 20:51717566-51717588 CTATCCTAAGCTATAGTCAAAGG + Intronic
1175683361 20:61007643-61007665 TTATTCAGAGCTATAATTAACGG - Intergenic
1176908290 21:14531372-14531394 CTATTCAATTTTATCATCAAAGG + Intronic
1178774619 21:35537921-35537943 CTATTCCAGGCAATGAACAAAGG - Intronic
1182166298 22:28177663-28177685 TTATTCAGGGCTAAAAACAATGG + Intronic
951805472 3:26639088-26639110 CTATTCAAGACTATATAGAATGG - Intronic
955546029 3:60031363-60031385 CTTTGCAATGCTATAGTCAAAGG - Intronic
957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG + Intronic
957900106 3:86478527-86478549 CTATTCATGGCTATTATAAGTGG + Intergenic
962174970 3:133143552-133143574 CCATACAAGGCAATAATAAAAGG - Intronic
962454460 3:135552391-135552413 CTATTCAAGGCTCCAATGTAAGG + Intergenic
968026202 3:195444245-195444267 CTCTTCAGTACTATAATCAAAGG + Intergenic
971169133 4:24215189-24215211 CTATACCAGGCTATAACAAATGG + Intergenic
971741629 4:30528674-30528696 CTATTCAAGGCAATCAGCACAGG - Intergenic
973387868 4:49526417-49526439 ATATCAAAGGATATAATCAAAGG - Intergenic
974652613 4:64774947-64774969 CTATTCAAGGTTATAAGTCAAGG + Intergenic
975094259 4:70438851-70438873 CTACTCCAGGTTATATTCAAGGG + Intronic
975294935 4:72723389-72723411 CTATTGAAAGCTATACTCAGTGG + Intergenic
975428705 4:74261443-74261465 CTTTTCAAATATATAATCAAAGG + Intronic
975749788 4:77510899-77510921 CTCTTCAAGTTTATATTCAAGGG - Intergenic
976970655 4:91098216-91098238 CTATCCAAGTCTATTAGCAAAGG - Intronic
980211627 4:129795697-129795719 ATAATCAATGCTATATTCAAAGG + Intergenic
980293824 4:130882993-130883015 CTATTTATGCCTATAACCAAGGG - Intergenic
982991942 4:162287279-162287301 TTATTCAAGGAAATAATTAAAGG + Intergenic
985298657 4:188463166-188463188 CTATTCAAGGCTTTTGTCAATGG - Intergenic
986226618 5:5821344-5821366 TTATTCAAGTCTCTCATCAAAGG + Intergenic
988073236 5:26322089-26322111 TTATTCAAGTTTGTAATCAAAGG + Intergenic
988157914 5:27478225-27478247 CTATTGAAGGTTATGTTCAATGG - Intergenic
988712063 5:33788673-33788695 TTTCTCAAGGCTATAATCCAAGG - Intronic
990044359 5:51410916-51410938 TTATTAAAGGCTATGGTCAAGGG + Intergenic
990349682 5:54903432-54903454 ATATTCAAAGGTATATTCAAGGG + Intergenic
992807675 5:80353638-80353660 AAACTCACGGCTATAATCAATGG + Intergenic
993174129 5:84460460-84460482 CTCTTCACAGCTATATTCAAGGG + Intergenic
994643338 5:102437474-102437496 TTAATTAAGGCTATTATCAATGG - Intronic
996684363 5:126264354-126264376 CTTTTCAAGAATATAATCATAGG - Intergenic
997763806 5:136478418-136478440 CTAATCCAGGCTATCATCCACGG - Intergenic
998122951 5:139594246-139594268 CTACTCAAGGATATAGTGAAAGG + Intronic
1005233947 6:23738047-23738069 ATGTTCAAGCCTAAAATCAAAGG - Intergenic
1012274807 6:97260231-97260253 ATATTAAAAACTATAATCAAAGG - Intronic
1012999654 6:106009509-106009531 ATATTCAAAGCTATAGTAAAGGG + Intergenic
1014207174 6:118668703-118668725 CTGTTCAAGGCTAAAATAAAGGG + Intronic
1014598196 6:123372408-123372430 CTGTGCAATGCTAAAATCAAGGG + Intronic
1015364451 6:132381678-132381700 TTATTCAAGTGGATAATCAATGG + Intronic
1021199205 7:17709202-17709224 CTTTGCAAAGCTATAAACAAGGG - Intergenic
1023235128 7:38078155-38078177 TTTTTTAAGGCTATAATAAATGG - Intergenic
1023504139 7:40882428-40882450 CTATGGAAGGCAATACTCAATGG + Intergenic
1023958354 7:44905919-44905941 ATATTCAAGGCTTTGGTCAATGG - Intergenic
1026686469 7:72514520-72514542 CCATTCAAGGCCATAGTCTAAGG - Intergenic
1027806069 7:82824496-82824518 TTATTCAAGGATATAAACCAAGG + Intronic
1028357938 7:89932100-89932122 CTATTCAAGTTTAAAGTCAATGG + Intergenic
1033309052 7:140246553-140246575 CAATTCAAGTCCAAAATCAAGGG + Intergenic
1033898437 7:146104978-146105000 CTATTCAAGAGTATAATCTTGGG + Intergenic
1040732159 8:50461306-50461328 GTAATCAAGGTTATTATCAATGG - Intronic
1041526154 8:58808493-58808515 CTGCTCAAGGGTATAATTAAAGG - Intronic
1041734974 8:61100590-61100612 CCATTTAAGTATATAATCAATGG + Intronic
1041913985 8:63121103-63121125 ATATTGAAGGATATAATCTAAGG - Intergenic
1042898817 8:73700561-73700583 TTATTTAAGGCTATTATAAATGG - Intronic
1043170677 8:76962028-76962050 CTATTGAAGACTAGAATCATAGG + Intergenic
1045763112 8:105634185-105634207 TTATTCAAGTTTTTAATCAACGG + Intronic
1048707970 8:137175797-137175819 CTATTCATGTCTATATGCAATGG - Intergenic
1051450337 9:17190718-17190740 CTTTTCAAGTCTAAAATCAAAGG - Intronic
1053465879 9:38308092-38308114 CAGTTGAAGGCTAGAATCAAAGG + Intergenic
1055764057 9:79642305-79642327 CTATTCATAGGTATAATCATAGG + Intronic
1058270283 9:102964241-102964263 TTATTCAAAGTTATAATCATAGG + Intergenic
1059771628 9:117431917-117431939 ATATTCAAGGCGAAATTCAAGGG + Intergenic
1059815900 9:117914559-117914581 CTATTTAATGCTATTATAAATGG - Intergenic
1061963460 9:133999767-133999789 CTAATCAAGGCTTTAAGGAAGGG + Intergenic
1189100141 X:38180490-38180512 CAGTTCAAGGCTAGAAACAATGG - Intronic
1193725666 X:85036227-85036249 CTATTCATGGCTATTGTGAATGG + Intronic
1194698751 X:97088581-97088603 CTCTACAAGGCTATATTGAATGG + Intronic
1194719561 X:97324234-97324256 CTATAGAAAGCTATAATAAAAGG + Intronic
1197060018 X:122166748-122166770 TTATTCAACCCTAAAATCAAAGG + Intergenic
1199591791 X:149474647-149474669 GTATTCAAGGCTATATGCAAAGG + Intergenic