ID: 942438095

View in Genome Browser
Species Human (GRCh38)
Location 2:176002600-176002622
Sequence ACCGCCGCGCGAGCGAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 23}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942438094_942438095 -9 Left 942438094 2:176002586-176002608 CCTGGTGGTCTCAGACCGCCGCG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 23
942438093_942438095 3 Left 942438093 2:176002574-176002596 CCTGAAACTGGTCCTGGTGGTCT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 23
942438092_942438095 4 Left 942438092 2:176002573-176002595 CCCTGAAACTGGTCCTGGTGGTC 0: 1
1: 1
2: 1
3: 15
4: 198
Right 942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 23
942438091_942438095 5 Left 942438091 2:176002572-176002594 CCCCTGAAACTGGTCCTGGTGGT 0: 1
1: 0
2: 3
3: 17
4: 174
Right 942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 23
942438087_942438095 28 Left 942438087 2:176002549-176002571 CCAAGTCTCGCTGGAGAAGGAAA 0: 1
1: 0
2: 0
3: 14
4: 146
Right 942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942438095 Original CRISPR ACCGCCGCGCGAGCGAAGAG TGG Intronic
900515212 1:3078493-3078515 ACCTCCGCGCCAGTGCAGAGAGG - Intronic
906044515 1:42817380-42817402 GCGGCCGCGCGTGCGCAGAGAGG + Intronic
906381377 1:45334156-45334178 ACCACCACGCGAGCATAGAGAGG + Intronic
917222635 1:172748325-172748347 TCTGCCGCGCGGGTGAAGAGCGG + Intergenic
1074618409 10:115093237-115093259 ACCGCCGGGCGGGCGAGGCGGGG + Intergenic
1094753488 12:33439767-33439789 CCCGCCGCGCGAGCGAGCCGAGG + Exonic
1110705102 13:78596120-78596142 CCCGGCGCGCGTGCGCAGAGTGG - Intergenic
1113911928 13:113846166-113846188 GCCGCCACGCGTGTGAAGAGCGG + Intronic
1122087425 14:99317440-99317462 ACCCCCATGCGAGGGAAGAGTGG + Intergenic
1127225195 15:56919733-56919755 ACCGCGGCGCGAGCAAGGGGCGG - Intronic
1138660752 16:58515705-58515727 ACCGCGGCGCGAGCGCAGAACGG - Intronic
1143482228 17:7234342-7234364 ACCGACGCGCGAGCGCGGACAGG + Exonic
1148323505 17:46771103-46771125 GCGGCCGCGGGAGCCAAGAGGGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1152714360 17:81891408-81891430 GCCGCCGCGCGAGTGAATCGAGG - Exonic
1160804233 19:984749-984771 AGCCCCGCGCGTGCGCAGAGCGG - Intronic
932329432 2:70889265-70889287 ACAGCCGCGCGAGCGGAGAGAGG - Intergenic
939153981 2:138502307-138502329 GCCGCCGCGCGAGGGAAGGGCGG - Intronic
942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG + Intronic
1178066375 21:28908702-28908724 TCCGCCACGCGAGCAAAGTGTGG + Intergenic
1178849354 21:36200344-36200366 ACCGCCGCGTGTGCCAGGAGAGG - Exonic
1183956060 22:41381523-41381545 CCCGACGCGCCACCGAAGAGGGG - Intronic
1001732865 5:173973117-173973139 GCCGCGGCGCAAGCGGAGAGAGG - Intergenic
1042858766 8:73293981-73294003 CCCGCCGGGCGGGCGAAGACTGG - Intronic
1050351044 9:4741364-4741386 GCGGCCGAGCGAGCGCAGAGGGG - Intronic
1062161182 9:135080868-135080890 ACCGCAGGGCGACCGAAGGGAGG + Intronic
1062389230 9:136327467-136327489 ACCGCCGCCCGCGCGGGGAGGGG - Exonic