ID: 942438766

View in Genome Browser
Species Human (GRCh38)
Location 2:176009434-176009456
Sequence TTGCTGACTTTGAAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942438763_942438766 22 Left 942438763 2:176009389-176009411 CCATCTCGAAAGAAAGAAAGAAA 0: 20
1: 132
2: 600
3: 5688
4: 107033
Right 942438766 2:176009434-176009456 TTGCTGACTTTGAAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942438766 Original CRISPR TTGCTGACTTTGAAAAAAAA TGG Intergenic
No off target data available for this crispr