ID: 942438807

View in Genome Browser
Species Human (GRCh38)
Location 2:176009918-176009940
Sequence CGCTGTATATATAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942438805_942438807 6 Left 942438805 2:176009889-176009911 CCTTTTAGAATTTTGACTAAAAA No data
Right 942438807 2:176009918-176009940 CGCTGTATATATAAGGCAGATGG No data
942438804_942438807 27 Left 942438804 2:176009868-176009890 CCTGTGGCTGAGATTGTTTCACC No data
Right 942438807 2:176009918-176009940 CGCTGTATATATAAGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942438807 Original CRISPR CGCTGTATATATAAGGCAGA TGG Intergenic
No off target data available for this crispr