ID: 942442974

View in Genome Browser
Species Human (GRCh38)
Location 2:176055187-176055209
Sequence TTGTATCTTCACATAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942442968_942442974 29 Left 942442968 2:176055135-176055157 CCTGTGAGGGCCTGCTTCCTGGT No data
Right 942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG No data
942442969_942442974 19 Left 942442969 2:176055145-176055167 CCTGCTTCCTGGTTTGCAAATTG No data
Right 942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG No data
942442970_942442974 12 Left 942442970 2:176055152-176055174 CCTGGTTTGCAAATTGTTTTGTG No data
Right 942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942442974 Original CRISPR TTGTATCTTCACATAGTGGA GGG Intergenic
No off target data available for this crispr