ID: 942444517

View in Genome Browser
Species Human (GRCh38)
Location 2:176069169-176069191
Sequence GGCCTCAAGCAGAGTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444517_942444523 -2 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444523 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
942444517_942444520 -9 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444520 2:176069183-176069205 CTTGAGGCCCCTCCCAGCAGGGG No data
942444517_942444529 5 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444529 2:176069197-176069219 CAGCAGGGGCCCTGGGAGGAAGG No data
942444517_942444519 -10 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444519 2:176069182-176069204 GCTTGAGGCCCCTCCCAGCAGGG No data
942444517_942444534 19 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444517_942444535 30 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444535 2:176069222-176069244 GTGGAAGACAGGACTGACTGAGG No data
942444517_942444521 -3 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444521 2:176069189-176069211 GCCCCTCCCAGCAGGGGCCCTGG No data
942444517_942444526 1 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444526 2:176069193-176069215 CTCCCAGCAGGGGCCCTGGGAGG No data
942444517_942444531 11 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444531 2:176069203-176069225 GGGCCCTGGGAGGAAGGTGGTGG No data
942444517_942444530 8 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444530 2:176069200-176069222 CAGGGGCCCTGGGAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444517 Original CRISPR GGCCTCAAGCAGAGTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr