ID: 942444522

View in Genome Browser
Species Human (GRCh38)
Location 2:176069190-176069212
Sequence CCCAGGGCCCCTGCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444522_942444534 -2 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444522_942444537 24 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG No data
942444522_942444536 23 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444522_942444531 -10 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444531 2:176069203-176069225 GGGCCCTGGGAGGAAGGTGGTGG No data
942444522_942444535 9 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444535 2:176069222-176069244 GTGGAAGACAGGACTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444522 Original CRISPR CCCAGGGCCCCTGCTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr