ID: 942444527

View in Genome Browser
Species Human (GRCh38)
Location 2:176069195-176069217
Sequence TTCCTCCCAGGGCCCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444527_942444537 19 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG No data
942444527_942444534 -7 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444527_942444536 18 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444527_942444535 4 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444535 2:176069222-176069244 GTGGAAGACAGGACTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444527 Original CRISPR TTCCTCCCAGGGCCCCTGCT GGG (reversed) Intergenic
No off target data available for this crispr