ID: 942444528

View in Genome Browser
Species Human (GRCh38)
Location 2:176069196-176069218
Sequence CTTCCTCCCAGGGCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444528_942444535 3 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444535 2:176069222-176069244 GTGGAAGACAGGACTGACTGAGG No data
942444528_942444534 -8 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444528_942444537 18 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG No data
942444528_942444536 17 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444528 Original CRISPR CTTCCTCCCAGGGCCCCTGC TGG (reversed) Intergenic
No off target data available for this crispr