ID: 942444533

View in Genome Browser
Species Human (GRCh38)
Location 2:176069207-176069229
Sequence TCTTCCACCACCTTCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444533_942444535 -8 Left 942444533 2:176069207-176069229 CCTGGGAGGAAGGTGGTGGAAGA No data
Right 942444535 2:176069222-176069244 GTGGAAGACAGGACTGACTGAGG No data
942444533_942444540 26 Left 942444533 2:176069207-176069229 CCTGGGAGGAAGGTGGTGGAAGA No data
Right 942444540 2:176069256-176069278 AGGGAGAGACTCATCTCATTTGG No data
942444533_942444537 7 Left 942444533 2:176069207-176069229 CCTGGGAGGAAGGTGGTGGAAGA No data
Right 942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG No data
942444533_942444536 6 Left 942444533 2:176069207-176069229 CCTGGGAGGAAGGTGGTGGAAGA No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444533 Original CRISPR TCTTCCACCACCTTCCTCCC AGG (reversed) Intergenic
No off target data available for this crispr