ID: 942444534

View in Genome Browser
Species Human (GRCh38)
Location 2:176069211-176069233
Sequence GGAGGAAGGTGGTGGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444528_942444534 -8 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444522_942444534 -2 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444515_942444534 22 Left 942444515 2:176069166-176069188 CCACCAAACAAACTCTGCTTGAG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444525_942444534 -4 Left 942444525 2:176069192-176069214 CCTCCCAGCAGGGGCCCTGGGAG No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444517_942444534 19 Left 942444517 2:176069169-176069191 CCAAACAAACTCTGCTTGAGGCC No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444527_942444534 -7 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444514_942444534 23 Left 942444514 2:176069165-176069187 CCCACCAAACAAACTCTGCTTGA No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data
942444524_942444534 -3 Left 942444524 2:176069191-176069213 CCCTCCCAGCAGGGGCCCTGGGA No data
Right 942444534 2:176069211-176069233 GGAGGAAGGTGGTGGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444534 Original CRISPR GGAGGAAGGTGGTGGAAGAC AGG Intergenic
No off target data available for this crispr