ID: 942444536

View in Genome Browser
Species Human (GRCh38)
Location 2:176069236-176069258
Sequence TGACTGAGGACCTTGAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942444525_942444536 21 Left 942444525 2:176069192-176069214 CCTCCCAGCAGGGGCCCTGGGAG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444528_942444536 17 Left 942444528 2:176069196-176069218 CCAGCAGGGGCCCTGGGAGGAAG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444522_942444536 23 Left 942444522 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444527_942444536 18 Left 942444527 2:176069195-176069217 CCCAGCAGGGGCCCTGGGAGGAA No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444532_942444536 7 Left 942444532 2:176069206-176069228 CCCTGGGAGGAAGGTGGTGGAAG No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444524_942444536 22 Left 942444524 2:176069191-176069213 CCCTCCCAGCAGGGGCCCTGGGA No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data
942444533_942444536 6 Left 942444533 2:176069207-176069229 CCTGGGAGGAAGGTGGTGGAAGA No data
Right 942444536 2:176069236-176069258 TGACTGAGGACCTTGAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942444536 Original CRISPR TGACTGAGGACCTTGAGCCA AGG Intergenic
No off target data available for this crispr