ID: 942447702

View in Genome Browser
Species Human (GRCh38)
Location 2:176088960-176088982
Sequence GTTCTCTCCATCCCAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942447697_942447702 12 Left 942447697 2:176088925-176088947 CCTCACTGTGTTTAATTTTTTCC No data
Right 942447702 2:176088960-176088982 GTTCTCTCCATCCCAAAGAAGGG No data
942447700_942447702 -9 Left 942447700 2:176088946-176088968 CCAAGGCTGGAGAAGTTCTCTCC No data
Right 942447702 2:176088960-176088982 GTTCTCTCCATCCCAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942447702 Original CRISPR GTTCTCTCCATCCCAAAGAA GGG Intergenic
No off target data available for this crispr