ID: 942450914

View in Genome Browser
Species Human (GRCh38)
Location 2:176107619-176107641
Sequence CAGCGGGGGCGGCCCCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 597}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942450899_942450914 16 Left 942450899 2:176107580-176107602 CCGCGGCGGCGGCGGCGGCGGCA 0: 6
1: 104
2: 213
3: 461
4: 1084
Right 942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG 0: 1
1: 0
2: 8
3: 76
4: 597
942450896_942450914 21 Left 942450896 2:176107575-176107597 CCGTACCGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 27
3: 223
4: 482
Right 942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG 0: 1
1: 0
2: 8
3: 76
4: 597
942450893_942450914 29 Left 942450893 2:176107567-176107589 CCAAGTGGCCGTACCGCGGCGGC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG 0: 1
1: 0
2: 8
3: 76
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942450914 Original CRISPR CAGCGGGGGCGGCCCCGGCG GGG Exonic
900119106 1:1041039-1041061 GAGCGGGGGCGGGGCCTGCGGGG + Intronic
900137916 1:1126263-1126285 CTCCCGGGGCGGCACCGGCGTGG + Intergenic
900151793 1:1182123-1182145 CAGCGGGAGGGGCCCGGGTGGGG + Intronic
900237572 1:1600057-1600079 CAGCGGGGACGGCGGCGGCGCGG - Exonic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900622283 1:3592961-3592983 CAGCCCGGGCTGCCCCGGGGAGG + Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
900687065 1:3955411-3955433 CAGCGGGGACACCCCCGCCGGGG - Intergenic
900792523 1:4689817-4689839 GAGAGGGGGCGGCCTTGGCGGGG - Intronic
900991894 1:6101955-6101977 CAGCCAGGGTGGCCCCGGCGGGG - Exonic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901641218 1:10694151-10694173 CGGCCGGCGCGGCCCCGGCTTGG + Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902823246 1:18956248-18956270 CGGCGGGGGCTGCCCTGGCGGGG - Exonic
903063469 1:20685541-20685563 CAGCCGGGGCAGCCCTGGCTAGG - Intronic
903153209 1:21427987-21428009 CAGGGGGGGCGTTCTCGGCGCGG + Intergenic
903233865 1:21937340-21937362 CTGCGGGGGCGGGGCGGGCGGGG - Intergenic
903291770 1:22318627-22318649 CAGAGGGGGCGGACCTGGCGGGG - Intergenic
903501010 1:23800263-23800285 GGGCGGGGGCGGCTTCGGCGCGG - Intronic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904006595 1:27366328-27366350 CTGCGGGGGCGGCCGCGGCCGGG + Exonic
904237390 1:29123983-29124005 CGGTGGGGCCGGGCCCGGCGCGG - Intergenic
904500132 1:30908544-30908566 CCCCGTGGGCGGCCCCGGCACGG + Exonic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905794382 1:40807423-40807445 CAGTGGCGGCGGCCCTGGTGTGG + Intronic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906640703 1:47438974-47438996 ATGCGGGGCCGGCCCCGGCGGGG - Exonic
906650188 1:47507817-47507839 GAGCGGGAGGGGCCCCGGTGGGG - Intergenic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907387715 1:54136735-54136757 CAGCGGGGCCAGCGCCTGCGTGG + Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907430105 1:54406547-54406569 CCGCGGAGGCGGCCGCAGCGGGG - Intronic
908355702 1:63323403-63323425 GAGCGGCGGCGGGCCTGGCGCGG + Exonic
912670423 1:111619806-111619828 CAGCGGGAGCGGCGGCGGCAGGG - Exonic
913161853 1:116152295-116152317 CAGCGTGGGCGGAGGCGGCGGGG - Intergenic
914201423 1:145488440-145488462 CAGAGGCGGCGACCCTGGCGAGG + Intergenic
914480545 1:148061567-148061589 CAGAGGCGGCGACCCTGGCGAGG + Intergenic
914702904 1:150150232-150150254 CAGCGGGCGCGGGCGCGGGGCGG - Exonic
914878616 1:151530591-151530613 CAGCGGGGGCTGGCCCGCCTGGG + Exonic
914878636 1:151530660-151530682 CAGCGGGAGGTGCTCCGGCGAGG + Exonic
915552246 1:156642035-156642057 GGGCGGGGGCGGCCCCGGGGAGG + Exonic
915912974 1:159925551-159925573 CAGACGGGGCGGACCCGGGGCGG + Intronic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916651747 1:166839823-166839845 CAGCGGAAGCGCTCCCGGCGCGG + Intronic
916717012 1:167455047-167455069 CAGCGGGAGGAGCCCAGGCGCGG - Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917974227 1:180229322-180229344 CGGCCGGGGAGGCCCCGCCGCGG + Intergenic
919981131 1:202643544-202643566 CAGCGCGTGCGGCCCCTCCGAGG + Intronic
920705044 1:208244430-208244452 CAGCGGGCGCGGCCCCAGCCCGG - Intergenic
920805779 1:209232055-209232077 CAGCTGGGCCGGCGCCGCCGGGG + Intergenic
922221195 1:223609902-223609924 CAGAGGGGGCGGCCACAGCTAGG + Intronic
922513183 1:226186559-226186581 CAGCGGTGGCGGCAGCAGCGGGG + Exonic
924198948 1:241640171-241640193 CTGAGGGGCCGGCGCCGGCGGGG - Exonic
924707984 1:246513535-246513557 CATAGAGGGCGGCCACGGCGAGG + Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1064028791 10:11869971-11869993 CGGCGGGGAAGGCGCCGGCGTGG - Exonic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1065023083 10:21516866-21516888 CGGCGGCGGCGGCCGCCGCGGGG - Exonic
1065100376 10:22325589-22325611 CCGCGGGGGCGGGGCCGGCGCGG - Intronic
1065687771 10:28302977-28302999 CAGCGGGCTCGGCACCGCCGCGG + Intronic
1065883765 10:30059287-30059309 CCGCGCGGGGGGCCCAGGCGGGG + Intronic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464423 10:35640388-35640410 CAGCGGTGGCGCGCCGGGCGCGG - Exonic
1067416470 10:46106630-46106652 GTGGGTGGGCGGCCCCGGCGCGG - Intergenic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1070162584 10:73874716-73874738 CAGCGAGGGCGGCTCCGGGGCGG - Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1073414265 10:103368210-103368232 CACCGGGGCCGCCCCCGCCGGGG - Exonic
1074377485 10:112951618-112951640 CAGCGGGCGGGGGCCGGGCGCGG - Intronic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1075401308 10:122163422-122163444 CAATGCGGGCGGTCCCGGCGAGG + Intronic
1076676169 10:132148817-132148839 CGGCAGGGGCGGCCCCTGTGTGG - Intronic
1076683530 10:132186903-132186925 CAGCGGGGGCGGGACCGGAACGG + Exonic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076805967 10:132858863-132858885 CAACGGGGGCTCCCCCGACGGGG + Intronic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1076917793 10:133433118-133433140 CAGCGTGGGCGGCTGCGGGGAGG + Intergenic
1076937787 10:133577193-133577215 CAGCGTGGGCGGCTGCGGGGAGG + Intergenic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080012340 11:27472048-27472070 CAGCGGGGGGCGCCGCGGGGCGG - Intronic
1080515465 11:33015842-33015864 CAGCGGGGGCGGGGCCTGCAGGG + Exonic
1081545077 11:44066090-44066112 AGGCGGGGGCGGTCTCGGCGGGG - Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083258151 11:61508966-61508988 CAGTGGCGGCGGCCCCGGCCGGG + Exonic
1083332520 11:61905519-61905541 CAGCGGGGCCAGCCCGGGCTGGG + Intronic
1083448507 11:62726991-62727013 CGGCGGGGCCGGGCCCGGCGGGG - Exonic
1083448563 11:62727220-62727242 CGGCGGCGGCGGCGCCTGCGCGG - Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083656990 11:64234580-64234602 CAGCGGCGGCGGGGACGGCGGGG - Exonic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1083780972 11:64917147-64917169 AAGCGGAGGCGGCCCAGGCCCGG - Exonic
1083899805 11:65638146-65638168 CAGCGCGGGCGGCGGCGGCTGGG + Intronic
1083945043 11:65918999-65919021 CGGCGGCGGCGGCCGTGGCGGGG - Exonic
1084420814 11:69059626-69059648 GAGCTGGGGCAGCCCCGGCGCGG - Intronic
1085312741 11:75525872-75525894 CAGCGGAGGTGGCAGCGGCGCGG - Exonic
1087505907 11:99020836-99020858 CAGCGCGGGCGGCCGGGGAGGGG + Intergenic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089845083 11:121452177-121452199 CAGCGGCGGCGGGCGCAGCGGGG + Intergenic
1090042335 11:123301898-123301920 CAGCAGGGGCGGCGGCGGCCTGG + Intergenic
1090163223 11:124517501-124517523 CAGCGGGGAGGGCCACGGCGAGG - Intergenic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090616751 11:128522223-128522245 GAGCGGGCGCGGCGCGGGCGAGG - Intronic
1092860735 12:12717289-12717311 CGGCGGGAGCCGCCCCGCCGAGG - Exonic
1094477706 12:30853943-30853965 CAGCGGAGGTGGACCCGGCCCGG - Intergenic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098105988 12:67069377-67069399 CAGCGGCGGCTGCCGCGGTGTGG + Intergenic
1100844520 12:98645044-98645066 CAGCGGCGGCGCGCCCGACGTGG - Exonic
1101910475 12:108857363-108857385 CAGCTCCGGCGGCCTCGGCGCGG + Intronic
1102046649 12:109833564-109833586 CAGCGAGGGCCTCCCCTGCGGGG + Intergenic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102300378 12:111767010-111767032 AAGAGGCGGCGGCCCAGGCGGGG - Exonic
1103120085 12:118372862-118372884 CAGCGGCGGCGGCCGCGGGAGGG - Exonic
1103595486 12:122022362-122022384 CAGCGGCCGCGGCCCCAGCCTGG - Intronic
1103688676 12:122752911-122752933 CGGCGGGAGCGGAGCCGGCGGGG + Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104697097 12:130872011-130872033 GAGCAGGGGCGGGGCCGGCGCGG - Exonic
1104929151 12:132329215-132329237 CAGCGGGGGCCTCACCCGCGGGG + Intronic
1104929230 12:132329444-132329466 CAGAGGGCGCGGCCCCGCCCCGG + Intergenic
1104929384 12:132329804-132329826 GAGCGGGGGCGGGGCAGGCGCGG + Intergenic
1104985415 12:132593782-132593804 CTGCGGCGATGGCCCCGGCGGGG + Intergenic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105943556 13:25171226-25171248 CGGCGGGGGCGACAGCGGCGGGG - Exonic
1106157384 13:27171446-27171468 CGGCCCGGGCGGCCCGGGCGGGG - Intronic
1107467637 13:40665126-40665148 CGGCGGGGGAGGGCGCGGCGAGG - Intronic
1108643637 13:52406175-52406197 CGTCGGGGGCGGGCCCCGCGGGG - Intronic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1110705976 13:78602266-78602288 CGGCGCGGGCGGCGCGGGCGCGG - Exonic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1112271904 13:97976481-97976503 CGGCGCCGGCGGCCGCGGCGGGG + Intronic
1112271948 13:97976604-97976626 GGGCGGGGGCGGGCCCAGCGCGG - Intronic
1112290823 13:98143115-98143137 CAGAGGCGGCGGGTCCGGCGCGG + Intronic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113378669 13:109784940-109784962 CAGCGAGGGCGACGGCGGCGCGG - Exonic
1113759648 13:112838487-112838509 CGGCAGGGGCGGCTCCGGGGTGG - Intronic
1113769487 13:112898986-112899008 AAGCGGGGGCAGACCCGGCATGG - Intronic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1115566585 14:34630044-34630066 CAGCGGGCGCGGGGCGGGCGCGG - Intronic
1120976578 14:90254215-90254237 CAGAGGGGGCGGGGCCGGGGTGG - Intergenic
1120990181 14:90368597-90368619 CAGCGGGGGCGGGCGGGGTGGGG + Intergenic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121103309 14:91264574-91264596 CCGCGGGGACGGCGCCTGCGGGG + Intergenic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122293878 14:100694212-100694234 GAGCGGGGGCGGCCCTTGGGAGG + Intergenic
1122444938 14:101761564-101761586 CAGCGGGGCGGGGCCGGGCGCGG + Intergenic
1122690366 14:103529346-103529368 CGGCGGGGGCCGCCCATGCGAGG - Intronic
1122859306 14:104575366-104575388 CAGCTCGGGGGGCCCCGGCTCGG + Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122975336 14:105168549-105168571 CGGCGGCGGCGGCGCGGGCGGGG + Exonic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1125516613 15:40324318-40324340 CTTCGGGGGCGGCGGCGGCGGGG + Intergenic
1125698517 15:41660039-41660061 CGGCCGGGGCGGAGCCGGCGAGG + Intronic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129052844 15:72796990-72797012 CCGCGAGAGCGGCCGCGGCGCGG + Intergenic
1129082329 15:73052217-73052239 GAGCGGGGGCGGGCCGCGCGCGG + Intronic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129738613 15:77979112-77979134 CAGTGGGAGCGGCCCAGGCTTGG - Intergenic
1129790933 15:78340255-78340277 GAGCGGGGGCAGGGCCGGCGGGG + Intergenic
1129933622 15:79431951-79431973 CCGAGGGGGCGGTCCCGGGGAGG - Intergenic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132683529 16:1153235-1153257 CGACGGCGGCGGCCTCGGCGCGG - Exonic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132843655 16:1990325-1990347 CGGCGGGGGAGGGGCCGGCGAGG - Intronic
1133464738 16:6018970-6018992 CGGCGGCGGCGGCGCTGGCGAGG + Intergenic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1135047678 16:19168372-19168394 CAGCGAGGGAGGCCGAGGCGGGG + Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135429852 16:22374174-22374196 CAGCGGGGGCCTCCCGGGCCAGG + Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136110983 16:28063545-28063567 CGGCGGCGGCGGACGCGGCGCGG + Intergenic
1136315983 16:29454971-29454993 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1136430560 16:30194313-30194335 CAGAGGAGGCGGACCCCGCGGGG + Intronic
1137926719 16:52547324-52547346 GAGAGGGGGCGGCCGCGGCGGGG - Intronic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138481184 16:57304297-57304319 CAGCTGGGGAAGCCCCGACGTGG + Intergenic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139489720 16:67279729-67279751 CCGTGGGGGCGGCCCCGCCATGG - Exonic
1139528571 16:67530533-67530555 CGGTCGGGGCGGCCCCGGGGTGG + Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141620504 16:85234740-85234762 CTGCGGGGGCGGAGCCGGGGCGG - Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1141644607 16:85360495-85360517 CAGCAGTGGCTGCCCAGGCGGGG - Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1142417043 16:89948831-89948853 CGGCGGGGTCGGGGCCGGCGGGG + Intronic
1142417051 16:89948846-89948868 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417059 16:89948861-89948883 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417111 16:89948966-89948988 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417119 16:89948981-89949003 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417164 16:89949071-89949093 CGGCGGGGACGGGGCCGGCGGGG + Intronic
1142417170 16:89949086-89949108 CGGCGGGGACGGGGCCGGCGAGG + Intronic
1142417205 16:89949178-89949200 CAGCGGCGGCGTCCCCGGGGTGG - Intronic
1142627796 17:1203413-1203435 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142627809 17:1203443-1203465 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142627822 17:1203473-1203495 CTGCGGGGGCGGGGCCCGCGGGG + Intronic
1142764519 17:2057779-2057801 CAGCCTGGACGGGCCCGGCGCGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143830207 17:9645388-9645410 CAGCGGGGGCGGCACCAGGCAGG + Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144171763 17:12665519-12665541 CAGCCGGGGCTTCCCCGGCCGGG - Intergenic
1144758576 17:17694650-17694672 CCGCGGAGGAGGCTCCGGCGCGG - Intronic
1145009982 17:19362469-19362491 CTGGGGGGCGGGCCCCGGCGGGG + Intronic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1146581154 17:34040009-34040031 CGGCGGTGGCTGCCCGGGCGGGG - Intronic
1147123717 17:38351970-38351992 CGGCGGGCGGGGCTCCGGCGGGG + Intergenic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147490753 17:40863828-40863850 CCGGGTGGGCGGCCCAGGCGAGG - Exonic
1147720440 17:42536467-42536489 CAGCCTGGGCGGCGGCGGCGCGG + Exonic
1147743073 17:42679614-42679636 CGGCGGGGGCAGCCGCGGCGGGG + Exonic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148262391 17:46194156-46194178 CAGCGGGCCCGGCGCCGGCGGGG - Intronic
1148336057 17:46842012-46842034 CCGCGGTGGCGCCCTCGGCGGGG + Intronic
1148855335 17:50576025-50576047 CACCAGGGGGGGCCCCGGAGAGG - Exonic
1148878607 17:50707821-50707843 CAGCAGGGGCGGCCCGCGGGAGG - Exonic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149564578 17:57631893-57631915 GAGCGGGGGCAGCCCAGGCCGGG - Intronic
1149599702 17:57885507-57885529 CGGCGGGGGTGGCACCGCCGGGG - Exonic
1149678604 17:58488163-58488185 CCGCTGGGACGGCCGCGGCGAGG - Exonic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150108611 17:62479137-62479159 CGGCGGCGGCTGCCCGGGCGGGG + Exonic
1150388850 17:64779741-64779763 GGGCGGGGGCGGGCCCGGCTCGG - Intergenic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1151317850 17:73335015-73335037 CAGCGGGGGCTGCCCCCACCTGG - Exonic
1151662431 17:75525847-75525869 CCGAGGGGGCGGGCCCGGCTGGG - Intronic
1152183527 17:78840325-78840347 GGGCGGGTGCGGCCCCGGGGCGG - Intronic
1152345535 17:79748481-79748503 CACCGCCGGCGGCCCAGGCGCGG - Intergenic
1152352888 17:79793192-79793214 GAGTGGGGACGGCCGCGGCGGGG - Exonic
1152389078 17:79992194-79992216 CAGCGGGGGGCACCCCGGGGAGG - Intronic
1152468089 17:80476812-80476834 CAGCAGCGCCGGCCCAGGCGGGG - Intronic
1152589196 17:81203099-81203121 CAGCGGGGGTGGACCGAGCGGGG - Intronic
1152751812 17:82065750-82065772 GCCCGGCGGCGGCCCCGGCGCGG - Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1154377923 18:13824101-13824123 GTGCGGAGGCGGGCCCGGCGCGG + Intergenic
1156008446 18:32470481-32470503 CAGCGGCGGCCGCCGAGGCGCGG - Intronic
1156099604 18:33578316-33578338 GGGCGGGGGCGGCGCCGGCCGGG - Intergenic
1156411121 18:36829016-36829038 CTGCGCGGCCGGCCCCTGCGGGG - Intronic
1156448498 18:37253742-37253764 AACCGGGGGCGGCCGGGGCGCGG - Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157384091 18:47247582-47247604 CTGCGGGGGCTGCCCCGGCGGGG + Intronic
1157867207 18:51197249-51197271 CGGCGGGGGCGGCTGCGGCAGGG + Exonic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160613969 18:80109732-80109754 GAGCGGGGGCCGCCCCGGGAGGG + Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160766023 19:808458-808480 AGGCCGGGGCGGCCCCGGGGTGG + Intronic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160792578 19:929443-929465 CGGCGGGGGCGGCCCCTGCGGGG - Exonic
1160823344 19:1068166-1068188 CAGCCGGGGCGGGGCCTGCGGGG - Intronic
1160832027 19:1108580-1108602 CAGCGGGCGCGGGGCGGGCGGGG + Exonic
1160858874 19:1229331-1229353 CGGCGGGGGGTGCCCCGGCTCGG - Exonic
1160909757 19:1469111-1469133 CAGCGGTGGCGGCCCACGCCGGG - Exonic
1160912176 19:1479556-1479578 CAGCGGGGGCGGGGCGGTCGCGG + Intronic
1160967917 19:1754583-1754605 GAGCGGCGGCGGCCCCAGCGCGG + Exonic
1161018855 19:1998446-1998468 CAGCAGGGGTGGCCCCAGCTGGG + Intronic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161388141 19:4007794-4007816 GAGCGGTGGCGGCGCCGGCCGGG + Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161557239 19:4950807-4950829 CATCAGAGGCAGCCCCGGCGGGG - Intronic
1161560409 19:4969567-4969589 CAGCGTGGGTGGCCCCGGCCGGG + Intronic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161802691 19:6424654-6424676 GGGCGGCGGCGGCCCGGGCGGGG + Exonic
1161802707 19:6424706-6424728 CGGCGGGGCCGGGCCTGGCGCGG + Exonic
1162131032 19:8526408-8526430 CAGAGGGGGCGGGGCCAGCGAGG - Intronic
1162395552 19:10416593-10416615 CCGCGGGGGCTTCCCCGGCTCGG - Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162935360 19:13979109-13979131 CAACGGGGGCGGCCGCGGGCGGG + Intronic
1162954333 19:14090070-14090092 CTGCTGTGGCGGCGCCGGCGGGG + Exonic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1163103282 19:15109897-15109919 CAGCGTGGGGGGCCCCGGGCCGG + Exonic
1163106329 19:15125029-15125051 CAGCGGGGGCGGCGGCCGCGGGG + Exonic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163431230 19:17268935-17268957 CAGCGTGGGCAGCCGCAGCGAGG + Exonic
1163666598 19:18606600-18606622 CAACGGCGGCGGCCGCCGCGCGG + Exonic
1164402090 19:27909685-27909707 CCGCGGGGGCGGCAACAGCGCGG - Intergenic
1165080426 19:33303193-33303215 GAGCGGAGGCGGCCTCGGCCCGG + Intergenic
1165227646 19:34365795-34365817 CAGGGCGGGCAGCCCGGGCGGGG + Intronic
1165741251 19:38206505-38206527 CAGCGGGGCAGGCCCGGGAGCGG - Exonic
1165939886 19:39409769-39409791 GAGCGGGGGCGGGCGCGGGGCGG + Intergenic
1166219073 19:41353770-41353792 CCGCGGGGCCGGCCTCGGCCCGG - Exonic
1166219169 19:41353992-41354014 GAGCGGGGGCGGCCCCCAGGGGG + Intronic
1166364656 19:42272396-42272418 CAGCGGGTGCTGGCTCGGCGTGG + Intronic
1166367206 19:42283906-42283928 CAATGGGGGCGGGCGCGGCGGGG + Intronic
1166921741 19:46233104-46233126 CAGTGGGGGCGTCCAGGGCGGGG - Intergenic
1167002856 19:46756172-46756194 CAGCGGGGGCTGGCGCGCCGCGG - Exonic
1167056144 19:47112555-47112577 CGGCGGGGGGGTCCCGGGCGCGG + Exonic
1167134432 19:47608678-47608700 GGGCGGGGGCGGCGCCGGCGCGG + Intronic
1167463857 19:49640049-49640071 GGGCGGGGGCGGCCCCGGGGCGG - Exonic
1167464317 19:49642207-49642229 CTGCGGCTCCGGCCCCGGCGCGG - Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168240436 19:55086452-55086474 CAGCGGGGCCTGTCCCAGCGGGG - Exonic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
1168311249 19:55461852-55461874 CAGGGGGGGCGGTGCCGGCAAGG + Intronic
926282985 2:11465690-11465712 CAGCGGGGTTGGCGGCGGCGCGG + Intronic
926581299 2:14634377-14634399 GGGCGCGGGCGGCTCCGGCGCGG - Exonic
926718582 2:15942571-15942593 CGGGCAGGGCGGCCCCGGCGCGG - Exonic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927714041 2:25341416-25341438 AGGCGGGGGCGGCCCGGCCGGGG + Intronic
927990200 2:27442286-27442308 CAGGGGGAGCGGGCCCGGGGCGG + Intergenic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929604176 2:43224531-43224553 GAGGTGCGGCGGCCCCGGCGGGG + Exonic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931274883 2:60735775-60735797 CAGCGGGGACGGGGGCGGCGAGG + Intergenic
931429288 2:62196378-62196400 CAGCGGGGAGGGAGCCGGCGGGG - Intronic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932231266 2:70086504-70086526 CAAGGGGGGCGGCCCCGTCAGGG - Intergenic
932492958 2:72133148-72133170 CAGTGGCGGCTGCCCCTGCGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933908023 2:86914183-86914205 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908034 2:86914211-86914233 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908069 2:86914307-86914329 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908143 2:86914518-86914540 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933911179 2:86942542-86942564 CGGCGGCGGCGGCCTCGACGTGG + Intronic
934011428 2:87824733-87824755 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934011459 2:87824816-87824838 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934966866 2:98731141-98731163 CGGCGGGGGCGGAGCCGGCGGGG - Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936370523 2:111898731-111898753 CAGCGGGGCCGGCCCCATCCCGG - Exonic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937091403 2:119208909-119208931 CAGCCAGGGCAGCCCCAGCGGGG - Intergenic
937203839 2:120223420-120223442 CGGCCGGGGCGGGCCCTGCGGGG + Intergenic
937950869 2:127387486-127387508 CGGCGGGGGCGGCCCCTCCTTGG - Intronic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
939969668 2:148644974-148644996 CAGCCCGGGCGGCGGCGGCGGGG - Exonic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942240812 2:173963731-173963753 CGGCGGGGGCGGGCCGCGCGCGG + Intronic
942449592 2:176100528-176100550 CGTGGGGGGCGGCCCCGGGGAGG + Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
943173329 2:184433110-184433132 CAGCGGGGGTGGCGCGGGGGAGG - Intergenic
943639678 2:190344144-190344166 CAGCGAGGCCGCCCCCGGCCGGG + Intronic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
944811178 2:203328654-203328676 CGGCGGGGGGGTCCCCGACGCGG - Intronic
945189029 2:207166931-207166953 CGGCGGCGGCGGCGCCCGCGGGG - Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946622355 2:221573283-221573305 CAGGGAGGGCTGCCCCGGCTAGG - Intronic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
948159374 2:235811720-235811742 CAGAGGGGCCGCCCCCGGCCCGG + Intronic
948425710 2:237885654-237885676 CAGGGAGGGCGGCCTCGGCCTGG - Intronic
948479341 2:238240239-238240261 CCGCGGGGGCGGCACCGGGGCGG + Intronic
1168773432 20:430364-430386 CAGCGGGGGCTGCCGCTGCAGGG + Exonic
1168806661 20:675731-675753 CGGTGGCGGCGGCCCCGGCTCGG + Exonic
1168893294 20:1307852-1307874 CTGCGGGGGCAGCCCCAGCCAGG - Exonic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1170524777 20:17226868-17226890 GGGCGGGGGCGGGCCCGGGGCGG + Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1173827605 20:46057659-46057681 CAGCGGCGGGGGGCGCGGCGAGG - Exonic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1175749211 20:61483672-61483694 CAGCGGGGGCGGGGCGGGGGGGG - Intronic
1175852104 20:62099213-62099235 CAGAGGGGACGGCCTCGGCATGG - Intergenic
1175899932 20:62355934-62355956 CAGCGGGGGCGGCTCCCAGGGGG - Intronic
1176177450 20:63735399-63735421 AAGCCGGGGCGGCCCCAGCGGGG + Exonic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176223133 20:63979404-63979426 CCGCGCGCACGGCCCCGGCGCGG + Exonic
1176281622 20:64316738-64316760 CAGCGGGGCGGGGCGCGGCGGGG + Intergenic
1176426648 21:6552652-6552674 CAGGTGGGACGGCCCCTGCGAGG + Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1178416953 21:32412298-32412320 CAGCTGGGGCGCCCCCGGGGCGG - Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179702139 21:43160974-43160996 CAGGTGGGACGGCCCCTGCGAGG + Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180064341 21:45405141-45405163 CAGCGGCGGCGGCTGCAGCGCGG + Intronic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180748757 22:18110593-18110615 CAGCGGGGACTGCGCCCGCGGGG - Intronic
1180796767 22:18609650-18609672 GCGCGCAGGCGGCCCCGGCGCGG - Exonic
1181026620 22:20131139-20131161 CAGCGCCGTCGGCCCCGGCCCGG + Intronic
1181094468 22:20495952-20495974 GCGCGGGGGCGGCCCTGGGGCGG + Intronic
1182355309 22:29720172-29720194 CAGCGGGGGCGGCGCCGCTCTGG - Exonic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183903358 22:41022239-41022261 CTGCGGAAGCGGCCCGGGCGCGG - Intergenic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1185037916 22:48489418-48489440 GAGCGCGGGCGGCGCGGGCGCGG + Intergenic
1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG + Intronic
1185061527 22:48609575-48609597 AAACGGGGGCGGCCCCGTCCTGG - Intronic
1185263838 22:49886991-49887013 CAGCGCGGACAGCCCCGGCCAGG - Exonic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185409518 22:50674605-50674627 CGGCGCGAGCGGCCCCGGCCCGG + Intergenic
1185413486 22:50697735-50697757 GCGGGGGGGCGGGCCCGGCGCGG + Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950072647 3:10164926-10164948 CTACGGGGCCGGCTCCGGCGCGG - Exonic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950433879 3:12967370-12967392 CAGCGGGTGAGGGCGCGGCGCGG - Exonic
950710623 3:14810740-14810762 CAGGGGGTGCGGGCCCCGCGGGG + Intergenic
950940370 3:16885054-16885076 CCGGGGGGGCGCCGCCGGCGGGG + Intronic
952287296 3:31981211-31981233 CCGCGGTGGCGGCCCCGGCACGG + Exonic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954246935 3:49339691-49339713 CCTAGGGGGCGGGCCCGGCGGGG - Intronic
954277954 3:49554656-49554678 CGGCGGCGCCGGCCCCGGCCCGG + Exonic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954733550 3:52685800-52685822 CAGCCGTGGCGGCCACGGGGCGG - Exonic
955387704 3:58492350-58492372 CAGCGGAGGTGCCCGCGGCGGGG + Intronic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
956761269 3:72447117-72447139 CGGCGGAGGCGGCGCTGGCGGGG - Intergenic
959056656 3:101574190-101574212 CTGCAGGGGAGGCCGCGGCGGGG + Exonic
960955428 3:123027618-123027640 CAGCGGGCGCGGGCCCGGGTGGG - Intronic
961202487 3:125055852-125055874 GAGCGGCGGCGGCCACCGCGAGG + Exonic
961652988 3:128426549-128426571 TGGCAGGGGCGGCCCCGGCGAGG + Intergenic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966868636 3:184276246-184276268 CAGAGGGGTCGGCCGCGGAGGGG + Intronic
968010436 3:195270846-195270868 CAGCGCGGGCGGCGAGGGCGCGG + Exonic
968178187 3:196569035-196569057 TAGCGGCGGCGGCGCGGGCGCGG + Exonic
968452896 4:683467-683489 CAGCCAGGGTGGCCCCGGGGTGG - Intronic
968514231 4:1009718-1009740 CGGTGGCGGCGGCGCCGGCGCGG - Intergenic
968514418 4:1010280-1010302 CAGCGGCGGCTGCGCCAGCGGGG + Intronic
968556192 4:1247663-1247685 CAGCGAGGACGGCCGCGGTGCGG + Intronic
968573460 4:1354276-1354298 CAGCGGGGGAAGCCACGGCAGGG + Intronic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
968775439 4:2536969-2536991 CGGCGGCGGCGGCTCGGGCGGGG + Intronic
968803203 4:2756333-2756355 CAGCCGGCGGGGCCCGGGCGCGG - Exonic
968879947 4:3293432-3293454 CCGCGGGGGCGGCGCCGGGCAGG + Intronic
968965676 4:3768043-3768065 CAGAAGGGGCGGCCCGGACGGGG + Exonic
968985110 4:3870783-3870805 CTGCGGGGGCACCCCCGGCGAGG + Intergenic
969559809 4:7939760-7939782 CGGCGGCGGCGGCCCCGCCCCGG - Exonic
969715853 4:8867792-8867814 CGGTGGGGGCGGCGCGGGCGCGG + Exonic
970202871 4:13627473-13627495 CCCCGGGGCTGGCCCCGGCGCGG - Exonic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
975522682 4:75317755-75317777 AAGCGGGGGCAGCCCCTGCCTGG + Intergenic
976569706 4:86594265-86594287 CCGGGGGGGCGGAGCCGGCGCGG + Intergenic
977536567 4:98261390-98261412 CAGGCGGCGCGGCCGCGGCGGGG - Intronic
982198173 4:152936432-152936454 AGGCGGGGGCGACCGCGGCGCGG + Intronic
984772162 4:183445142-183445164 CCGCGGGACCGGCCTCGGCGGGG + Intronic
984966338 4:185143408-185143430 CAGCGGCGACGCCCCCGGCCAGG - Exonic
985068384 4:186144813-186144835 GAGGGGAGGCGGCGCCGGCGCGG + Intronic
985542621 5:493882-493904 CAGCGGGGGTTGGCCCGGGGAGG + Intronic
985619783 5:948120-948142 CTGAGGGAGCGGCCCAGGCGTGG + Intergenic
985782301 5:1877777-1877799 AGGCGGTGGAGGCCCCGGCGTGG + Exonic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050487 5:14143806-14143828 CTGCGGGGGCGGTGCCGGCGAGG + Exonic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
992269935 5:75053555-75053577 CTGCGGAGGCCGCCCCGGCGGGG + Intergenic
992468531 5:77030786-77030808 CGGCGGCGGCGACCGCGGCGGGG - Exonic
992627326 5:78648062-78648084 CAGCAGGGGCGACCACGGGGCGG + Intronic
992939511 5:81750031-81750053 CGGGAGGGGCGGGCCCGGCGGGG - Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
995512346 5:112921878-112921900 CAGCCTGGGCAGCCCCCGCGGGG + Intronic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
997201287 5:132011560-132011582 CAGCGGGGCCCGGCCCGGCCCGG + Exonic
997463447 5:134071259-134071281 CAGCGGGGGCGGCGCCGTGCGGG + Intergenic
997652915 5:135535550-135535572 CGGCGCGGGCGGCCCCGAAGCGG + Exonic
998133165 5:139661157-139661179 CGGCGCGGGCAGCCGCGGCGGGG - Intronic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998467447 5:142357147-142357169 AAGCGGGGGCGGCCGGAGCGCGG - Intergenic
999293260 5:150441455-150441477 CAGCAGGGGAGGGCCAGGCGTGG + Intergenic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1002066996 5:176656845-176656867 GAGTGAGGGCGGCCCCGGCAAGG - Intronic
1002498880 5:179634480-179634502 CGGAGGAGGCGGCCCTGGCGCGG - Intronic
1002502796 5:179658044-179658066 CGGAGGAGGCGGCCCTGGCGCGG + Intergenic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003921573 6:10838200-10838222 CCGCGGGGGCCGGCCTGGCGTGG - Intronic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1004874798 6:19940581-19940603 CAGCAGGGGCGGCCCGGCAGAGG - Intergenic
1006804935 6:36781915-36781937 CAGCGGGGATGGCCCCAGCAAGG + Intronic
1006986218 6:38177376-38177398 CAGCGGGGTGGGCCACGGAGCGG - Intronic
1007492683 6:42236259-42236281 CTGCAGGGGCGGCCCCTCCGTGG + Exonic
1010244960 6:73654046-73654068 CGGCGGGGGCGGAGTCGGCGCGG - Exonic
1011607372 6:89118087-89118109 GGGCGGGGGCGGCGCCGGCGCGG + Intergenic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1015910228 6:138162011-138162033 CAGCGGCGGCTTCCCCGGCCCGG + Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017671970 6:156777709-156777731 CGGCGGCGGCGGCGCGGGCGCGG + Intergenic
1017672499 6:156779568-156779590 CCGCGGGGGCGGCGGGGGCGCGG + Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019472643 7:1229678-1229700 CAGAGGCCGCGGCCCGGGCGGGG + Intergenic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1020212042 7:6164872-6164894 CACCGCGGGCGGCCCCTCCGCGG - Exonic
1021998340 7:26201640-26201662 CAGCGGGCGCGCGCCCGGCGGGG - Intronic
1023287102 7:38631389-38631411 CAGCGGGGCTGGCGGCGGCGCGG + Exonic
1023418260 7:39951233-39951255 CTGCTGCGGCGGTCCCGGCGGGG - Exonic
1023955630 7:44884871-44884893 CGGCGGTGGCGGCTTCGGCGCGG - Exonic
1023995718 7:45157903-45157925 GAGTGGGGGCGCCCCCGGTGCGG - Intronic
1025692988 7:63761509-63761531 CTGCGGGGGCCGCCCCAACGCGG - Intergenic
1026740667 7:72976489-72976511 CAGCGGTGGCGACCCCGAGGAGG - Intergenic
1027103065 7:75388582-75388604 CAGCGGTGGCGACCCCGAGGAGG + Intergenic
1027654985 7:80919238-80919260 CCGCGGGGGCGGACCGGGCGGGG + Exonic
1028585568 7:92447894-92447916 CGGCGGCGGCGGCTTCGGCGCGG + Exonic
1029123199 7:98281738-98281760 CGGCTCGGTCGGCCCCGGCGGGG - Exonic
1029269066 7:99365702-99365724 CAGCAGGGGGAGCCCCGGCCTGG + Intronic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1030033443 7:105388914-105388936 CGGCGGCGGCGGCGCAGGCGCGG - Intronic
1031253104 7:119413436-119413458 CAGCGGGGTGGGCCCGGGGGAGG + Intergenic
1032591331 7:133194466-133194488 CAGCGGGGGAGGCCCAGCCAGGG - Intergenic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033654025 7:143361791-143361813 CAGCGGGGGCCGGCGGGGCGGGG - Intronic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034877703 7:154739847-154739869 CAGTGGGGGCGGCTTCAGCGTGG + Intronic
1036910629 8:12754875-12754897 CAGAGGCGGCGGCCGCGGGGCGG + Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037529244 8:19757403-19757425 CGGCGGGGGCGGCCAAGGCCGGG + Intronic
1039843377 8:41309123-41309145 CAGCGAGGGGGGCCGCCGCGGGG - Exonic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049577115 8:143394524-143394546 CAGCGGGTGCTGCCCTGGTGAGG + Intergenic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049689333 8:143951880-143951902 CAGTGGGGGCGGCAGCAGCGGGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049694491 8:143976762-143976784 CGGCGGAGGCGGCGCAGGCGGGG + Intergenic
1049788525 8:144462612-144462634 CGGCGGGGGCGGCCCGGCCGCGG - Intronic
1050356971 9:4792842-4792864 AAGCGGGGGCCGCCCCGGTCGGG + Intronic
1052016083 9:23469512-23469534 TAGCGGGGGAGGGCCGGGCGTGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052824943 9:33167493-33167515 CAGCGGGCGGGGCGCCGTCGTGG + Intergenic
1053014102 9:34652126-34652148 CAGCGGGGGTGGCTCCGCCCAGG - Intronic
1053050675 9:34958404-34958426 AAGCGGGGGCGGGGGCGGCGGGG + Intronic
1053072897 9:35111511-35111533 GAGCCGGGGCGGCCCCGGGGAGG - Exonic
1053129246 9:35605716-35605738 GAGGAGGGGCGGCCCCGGCCCGG - Exonic
1053306212 9:36986351-36986373 CCGCCGGCGCGGCCGCGGCGGGG - Intronic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1057352899 9:94315536-94315558 CAGTTGGGGCGGCCCCGGGCAGG - Intergenic
1057654848 9:96942055-96942077 CAGTTGGGGCGGCCCCGGGCAGG + Intronic
1057695274 9:97318590-97318612 CAGGAGGGGCGGCCCAGGAGGGG + Intronic
1058866653 9:109167177-109167199 CAGCGGGGGCGCCGCGGGCGCGG + Exonic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060484953 9:124041033-124041055 CTGCGGGGGCGCCCCCAGCCCGG + Intergenic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061417964 9:130458290-130458312 CAGCGGGGGTGGCCCCGTATAGG + Intronic
1061506787 9:131036187-131036209 CAGCGAGTGCGGCCCCGACGTGG + Exonic
1061873868 9:133534509-133534531 CGGCGGCGGCGGCCCAGGAGCGG - Intronic
1061961914 9:133992827-133992849 CAGGGGGCGCGGCCACGGCCGGG + Intergenic
1062449966 9:136611103-136611125 CAGGGGGGGCGGCCGTGGGGGGG + Intergenic
1062463296 9:136670824-136670846 CAGCGGGGGCGGCAGAGGCCTGG + Intronic
1062499673 9:136846984-136847006 CCGCGCGGCCGCCCCCGGCGCGG + Exonic
1062537753 9:137028315-137028337 AAGCGGGGGCGGGCGGGGCGCGG - Intronic
1062556219 9:137114428-137114450 CGGCGGGGGCGGCCGGGCCGGGG + Intronic
1062610509 9:137371418-137371440 CATCGGGGGCTGCCCTGGCCGGG - Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696223 9:137877664-137877686 GGGCGGGGGCGGCCGCGGGGCGG + Intergenic
1062696238 9:137877698-137877720 CAGGGTGGGCGGGGCCGGCGCGG + Intergenic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203773851 EBV:62189-62211 CAGTGGGGGCGGGGCCGGCGGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185508242 X:644368-644390 CTGCGGGAGCGGACCCGGCGGGG - Intronic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1187547324 X:20266779-20266801 CAGCGGCGGCGGCCCCAGAGAGG + Exonic
1189322986 X:40097492-40097514 CCTCGGGGTCGGCCCCGCCGAGG + Intronic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1195716957 X:107826721-107826743 CAGCCTGGCCGGGCCCGGCGCGG + Intronic
1198312721 X:135437023-135437045 CAGCGGGCGCGTCCCGGGCAGGG - Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198800120 X:140439687-140439709 TAAAGGGGGCGGACCCGGCGCGG + Intergenic
1199772833 X:150984712-150984734 CCGCAGCGGCGGCCCGGGCGGGG - Intronic
1200002595 X:153069703-153069725 GGGCGGGGGCGGCCGAGGCGGGG + Intergenic
1200005129 X:153080307-153080329 GGGCGGGGGCGGCCGAGGCGGGG - Intergenic
1200098178 X:153673842-153673864 CGGAGGGGGCGGGGCCGGCGGGG - Intronic
1200224762 X:154411455-154411477 CAGCGAGGCCAGCCCCGGGGCGG - Intronic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic