ID: 942451504

View in Genome Browser
Species Human (GRCh38)
Location 2:176110920-176110942
Sequence AAGGCTGAGAATTCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942451497_942451504 6 Left 942451497 2:176110891-176110913 CCTTCTAGCTGCTTTCACTACAG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942451504 Original CRISPR AAGGCTGAGAATTCTGGCGG GGG Intronic
900375181 1:2350981-2351003 AAGGGTGTGAAGTCTGGAGGTGG + Intronic
902660786 1:17901835-17901857 AAGGAAGAGAATTCTGACAGAGG - Intergenic
903817659 1:26076538-26076560 AAGGCATAGAATGCTGGGGGAGG - Intergenic
904543988 1:31254040-31254062 AAGGCTGAGAACACTGGTGCTGG - Intergenic
906171047 1:43725540-43725562 AAGACAGAGAATTCTGGCTGTGG - Intronic
906330937 1:44883645-44883667 TAGCCTCAGAATTCTGGGGGAGG + Intronic
912507969 1:110169600-110169622 AAGGCTTAGAATACTGACCGAGG + Intronic
914417704 1:147499166-147499188 AAGGCTGAGCATTCTGCAGTTGG + Intergenic
915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG + Intronic
916877363 1:168983737-168983759 GAGGCTGAGAAACCTGGCTGTGG - Intergenic
917222116 1:172743066-172743088 AAGGCTGAGAATTAGGTGGGTGG + Intergenic
917670967 1:177273200-177273222 AAGGCGGAGAATGCTGGAGAAGG - Intronic
917795621 1:178530768-178530790 AAGGCTGAGAATTCTAGTGATGG - Intronic
921582248 1:216908448-216908470 AGGGCTGAGAATTTTGGTGCTGG + Intronic
923103249 1:230834336-230834358 AAGGCTGAGAAATCCTGAGGTGG - Intergenic
923960534 1:239077755-239077777 GAGGCTGAGAATTGTGGTGGTGG + Intergenic
1064247672 10:13682231-13682253 AAGGCTAGGAATAGTGGCGGGGG - Intronic
1064301526 10:14127193-14127215 AAGGCTCAGCATTCAGGTGGAGG + Intronic
1067718996 10:48712580-48712602 AAGGCTGAGCACTCTGGCTCTGG - Intronic
1068451735 10:57198148-57198170 AAAACTGAGAATTCTGGGGCTGG + Intergenic
1069597986 10:69685002-69685024 AAGGCAGAGAATGCTTGTGGAGG + Exonic
1072044150 10:91637877-91637899 AAAGGTGAGGATTCTGGCTGGGG + Intergenic
1074173461 10:110970206-110970228 GAGGCTGAGAAGGGTGGCGGGGG - Intronic
1082000756 11:47392782-47392804 ATGGCTGAGAATGATGGCCGGGG + Intergenic
1082820107 11:57538851-57538873 AGGGCTGTGAATGCTGGGGGTGG + Intergenic
1083476274 11:62917604-62917626 AAGGCTGGGAATGGTGGAGGTGG + Intronic
1083980601 11:66165325-66165347 AAGGCTTAGAAGTCTGGCAGAGG - Intronic
1084647367 11:70466269-70466291 AGGGCTAAGAATTCAGGAGGCGG - Intergenic
1089125615 11:116174560-116174582 GAGGCAGAGAATTCTGGAGAGGG + Intergenic
1089420315 11:118327761-118327783 AAGGCTGTGTATTCTGTTGGTGG - Intergenic
1090067020 11:123511693-123511715 AAGGCTCAGACTTCTGGAGCAGG + Intergenic
1090090429 11:123692169-123692191 AAGGCTGGGAAGTCTGGCAAGGG + Intergenic
1098392046 12:69979838-69979860 ATGGCTGAGAATGCTGGCTCTGG - Intergenic
1099529754 12:83763372-83763394 AAGGCAGAGACTTCAGGCAGAGG - Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1105291817 13:19058299-19058321 AAGGCTTAGGATTGTTGCGGGGG - Intergenic
1105627532 13:22127250-22127272 GAGCCTGAGAATTCTGGTGATGG + Intergenic
1106173517 13:27309041-27309063 AAGGATGAGAAGTTTGGCTGGGG - Intergenic
1109696994 13:65973773-65973795 AAGGCTGGGAATTGTAGGGGAGG - Intergenic
1111375912 13:87379186-87379208 AAAGCTGAGAATTCTGGGGATGG + Intergenic
1113738473 13:112694533-112694555 AAGGCTGAGCATCCCGGCGTGGG + Intronic
1113775018 13:112939244-112939266 GAGGCTGAGAAACCTGCCGGAGG - Intronic
1115122531 14:29954599-29954621 TAGGCTGAGAATTCTTGAGGAGG + Intronic
1117420844 14:55543498-55543520 AAGCCTAAGAATTCTGGCATCGG + Intergenic
1117441524 14:55764041-55764063 GAAGCTGAGAATTCAGGCAGAGG + Intergenic
1119479167 14:74949153-74949175 GAGGCTGAGAATGCTGGTGGGGG + Intronic
1119686888 14:76640204-76640226 AAGGCTGAGAAATATGTCAGTGG - Intergenic
1122878449 14:104679347-104679369 AAGGCTGGGCATCCTGGGGGAGG + Intergenic
1123987792 15:25660083-25660105 AAGCCTGTGAACTCTGGCAGTGG + Intergenic
1128646086 15:69379935-69379957 AAGGCTGAGGATGCAGGCAGTGG - Exonic
1129703676 15:77782648-77782670 AAGGCTGAGAGTCCTGGTCGGGG - Intronic
1129924779 15:79354444-79354466 ATGGCTGAGGGTTCTGGCTGCGG - Intronic
1135635466 16:24071805-24071827 AAGGCTGAAAGTTATGGTGGGGG + Intronic
1138249568 16:55491674-55491696 AAGGCTGAGAACCCTGGAAGCGG - Intronic
1138761455 16:59549230-59549252 AAGGCAGAGAATCCAGGCAGAGG + Intergenic
1141763050 16:86041442-86041464 AAGGCTTAGGATTTTGGCGAAGG - Intergenic
1142050676 16:87956089-87956111 AAGGCTAACAATCCTGACGGGGG - Intronic
1142670401 17:1485343-1485365 AAGGCCCAGATTTCTGGCCGGGG + Intronic
1146662333 17:34673152-34673174 AAGACTGACAATCCTGGAGGAGG + Intergenic
1148145727 17:45363616-45363638 AAGGCTGGGAAGTGTGGAGGAGG - Intergenic
1150872498 17:68928932-68928954 AAGGCTTAAAATTCTAGCGAAGG - Intronic
1152231508 17:79116260-79116282 AAGGCTTAAAATTCTTGAGGTGG - Intronic
1152457427 17:80424319-80424341 CAGGCTGGTATTTCTGGCGGCGG - Intronic
1153883145 18:9438127-9438149 AAGCCTGAGAATTCTAGAGCAGG + Intergenic
1155378462 18:25188884-25188906 GAGGCTGAGGATTGTGGCTGAGG - Intronic
1155743221 18:29316400-29316422 CAGGCTGAAAATTCTGGCAGGGG - Intergenic
1158228595 18:55228394-55228416 AATGCTGAGGCTTCTGGCAGAGG + Intronic
1160585195 18:79910045-79910067 AAGGCTGGGGACTCTGGCGAGGG - Intronic
1160756209 19:758246-758268 AAGGCTGAGAATTCTAGCTGGGG - Exonic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1165899948 19:39164659-39164681 AAGGCTGTGAACTCTGGAGTGGG + Intronic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166651870 19:44581004-44581026 CAGGATGAGACTTCTGGCTGAGG - Intergenic
1167024925 19:46908776-46908798 AAGCATGAGAACTGTGGCGGGGG + Intergenic
1167160898 19:47766468-47766490 AAGGGTGTGGATTCTGGCAGTGG + Intergenic
1167460880 19:49624211-49624233 GAGACTGAGAATTCTGGGGTAGG + Intronic
1167460898 19:49624277-49624299 GGGGCTGAGAATTCTGGGGTAGG + Intronic
1167460926 19:49624409-49624431 GGGGCTGAGAATTCTGGGGTAGG + Intronic
1168106344 19:54168073-54168095 AAGACTGAGGATTCTTGGGGAGG + Intronic
927501293 2:23585024-23585046 AAGACTGAGTAGGCTGGCGGTGG - Intronic
928036934 2:27833230-27833252 AAGGTTCAGAATTCTCCCGGTGG + Intronic
928662535 2:33517772-33517794 AAGGGTGAGAATGCTGTTGGTGG - Intronic
929269366 2:39956740-39956762 TAGGCTCAGAATTGTGGAGGCGG + Intergenic
929274951 2:40014980-40015002 AAGGCTGATAACTATGGCTGAGG + Intergenic
930155427 2:48102725-48102747 AGGCCTCAGAATTATGGCGGGGG + Intergenic
932648977 2:73534655-73534677 AAGAATGAGAATTCTAGAGGAGG - Intronic
935042321 2:99444512-99444534 AAGCCTAAGAATTCTGTGGGTGG - Intronic
936766378 2:115853973-115853995 AAAGCTGGGAATTGTGGAGGAGG - Intergenic
939258145 2:139771662-139771684 AAGGCTGGGAAGTCTGAAGGAGG - Intergenic
941602247 2:167558000-167558022 AAGGCTGAGCATTCTGAAGCAGG - Intergenic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
943488841 2:188523505-188523527 AAAGCTGAGAATTCTGTTGAAGG - Intronic
946825022 2:223668961-223668983 AGGACTGAGAATTTTGGAGGAGG + Intergenic
948459489 2:238122288-238122310 AGGGATGAGAAGTCTGGCTGTGG - Intronic
1172135845 20:32686191-32686213 AAGGCTGTGAGTTATGGAGGAGG - Intergenic
1172571703 20:35975717-35975739 AAGGCAGAGAAATATGGGGGTGG - Intronic
1174832656 20:53827226-53827248 AAGGCTGAGCATTCTAGCTCAGG + Intergenic
1175374217 20:58513876-58513898 ATGGCTGAGAATTCTGGCCCTGG - Intronic
1176059213 20:63164970-63164992 AGGGCTGAGAACTCAGGTGGAGG + Intergenic
1180196268 21:46196231-46196253 AGGGCTTAGAGTTCTGTCGGCGG - Exonic
1182805974 22:33070709-33070731 ACAGCTGAGGCTTCTGGCGGAGG + Intergenic
1184996455 22:48210736-48210758 AAGGCTCTGACTTCTGGCAGAGG - Intergenic
950967361 3:17155543-17155565 AAGGCTAAGAATGCTGGCTGTGG + Intergenic
951979426 3:28549033-28549055 AAGGCTGACCATTCTAGCTGGGG + Intergenic
954993642 3:54862427-54862449 AAGGCTCAGCATTCTGACGTTGG + Intronic
957119143 3:76067108-76067130 CAGGCTGTGAATTCTGGAGTCGG + Intronic
959797591 3:110450197-110450219 GAGGCTGAGAAATATGGTGGGGG - Intergenic
963481897 3:145886485-145886507 AAGGCTGATAATTCAGAAGGTGG - Intergenic
964485621 3:157182550-157182572 AAGGTTGAGAATCATGGCAGAGG - Intergenic
965711609 3:171561376-171561398 AAGGCTGGGAATTTTGAGGGAGG + Intergenic
967446443 3:189572682-189572704 AAGGGTGAGAAAGCTGGCTGGGG + Intergenic
972972201 4:44591483-44591505 AATCCTGAGAATTGTGGCTGTGG + Intergenic
975344744 4:73281411-73281433 AAGGCAGAGGATTCTGGAGCAGG + Intergenic
989565482 5:42897281-42897303 AAGCCTAAGAATTCTGATGGTGG - Intergenic
992734712 5:79707177-79707199 AAAGCTGACAATTCTTGCAGTGG - Intronic
993077630 5:83254178-83254200 AACACTGAGAATTCTGGAGGTGG + Intronic
996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG + Intronic
997396663 5:133565585-133565607 AAGGCTGACACTTCCAGCGGTGG + Intronic
997610472 5:135212438-135212460 AAGGCTGTGACTTCTGTCAGCGG - Intronic
999217568 5:149947981-149948003 AAGGTTGAGAAACCTGGCTGTGG - Intergenic
999500762 5:152144392-152144414 AAAGCTGAGGATACTGGCAGAGG + Intergenic
999536182 5:152519725-152519747 GTGGCTGAGAATGCTGGTGGTGG - Intergenic
1005041167 6:21601798-21601820 AAGGCTGAGAAATCTGTCCAAGG - Intergenic
1005242121 6:23843069-23843091 ACTGTTGAGAATTCTGGCAGCGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006914457 6:37585376-37585398 ACGGCTCAGAATCCTGGCAGAGG - Intergenic
1010161493 6:72861964-72861986 TAGGCTGAGAAAACTGGCAGAGG - Intronic
1011563745 6:88650983-88651005 AAAGCTGAGAATTCTTGCATTGG - Intronic
1019474471 7:1237233-1237255 AAGGCTGAGGATTCTCGTTGTGG - Exonic
1020373182 7:7457086-7457108 AAGTCAGAGAATTATGGCAGTGG + Intronic
1023552868 7:41388239-41388261 AAGGGTGTGAATGCTGGCCGAGG + Intergenic
1033143959 7:138855030-138855052 AATGCTGAGCATTCTGGGGATGG - Intronic
1036922927 8:12875000-12875022 AAGGATGTGAATTCTGACTGGGG + Intergenic
1038500320 8:28038200-28038222 AAGGGAGAGCATTCTGGTGGGGG - Intronic
1049324566 8:142015269-142015291 ATGCCTGAGAATTCTTGAGGTGG - Intergenic
1049368389 8:142251859-142251881 AAGACAGAGAATGCGGGCGGCGG - Intronic
1049935951 9:502499-502521 AAGGCTGGGAATTCTGGGGATGG + Intronic
1050617963 9:7422554-7422576 AAGGCTGAGAATGGTAGTGGGGG - Intergenic
1053144504 9:35703375-35703397 AGGGCTGAGAAGGCTGGAGGAGG + Intronic
1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG + Intronic
1060740594 9:126095449-126095471 AAGGCTGAGAAATCCGGTGGAGG + Intergenic
1061442949 9:130618969-130618991 AAGGCTGGGAGCTCTGGAGGAGG - Intronic
1061746424 9:132743509-132743531 AAGGCTGGGGAATCTGGCGGTGG - Intronic
1188248222 X:27859377-27859399 AAGGCAGAGAAGTCTGGGTGGGG + Intergenic
1195139454 X:101944354-101944376 AAGGCTGAGTGTACTGGCTGTGG - Intergenic