ID: 942451796

View in Genome Browser
Species Human (GRCh38)
Location 2:176112734-176112756
Sequence CAGCCAGATGTGCAGCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942451796_942451803 -1 Left 942451796 2:176112734-176112756 CCCAGCGGCTGCACATCTGGCTG No data
Right 942451803 2:176112756-176112778 GTGCGGGGGCCCCTTGGACTTGG No data
942451796_942451802 -7 Left 942451796 2:176112734-176112756 CCCAGCGGCTGCACATCTGGCTG No data
Right 942451802 2:176112750-176112772 CTGGCTGTGCGGGGGCCCCTTGG No data
942451796_942451804 3 Left 942451796 2:176112734-176112756 CCCAGCGGCTGCACATCTGGCTG No data
Right 942451804 2:176112760-176112782 GGGGGCCCCTTGGACTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942451796 Original CRISPR CAGCCAGATGTGCAGCCGCT GGG (reversed) Intronic
No off target data available for this crispr