ID: 942454419

View in Genome Browser
Species Human (GRCh38)
Location 2:176128549-176128571
Sequence CATTGAAACGGGAGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942454415_942454419 -6 Left 942454415 2:176128532-176128554 CCATTGCATTTATTGGACATTGA 0: 1
1: 0
2: 0
3: 20
4: 219
Right 942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942454419 Original CRISPR CATTGAAACGGGAGCAGAGA GGG Intergenic
901112490 1:6809653-6809675 GATTGGAAGGGGAGCAGAGAAGG + Intronic
904839106 1:33359715-33359737 CTTTGGAAGGAGAGCAGAGAAGG + Intronic
909113926 1:71510583-71510605 AATTGAAACTTAAGCAGAGAAGG + Intronic
909412431 1:75370725-75370747 CTTTGATACGGGATCAGAGTGGG + Intronic
912221814 1:107686342-107686364 TATTGAAAGGGAAGCAGAGGAGG + Intronic
912806785 1:112763142-112763164 GATTGAGAGGGGCGCAGAGATGG - Intergenic
913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG + Intronic
914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG + Intergenic
914150609 1:145038802-145038824 CATTGTAAAGGGAGTAGGGAAGG - Intronic
915505235 1:156351280-156351302 TATAGAAACCGGAGAAGAGAAGG - Intronic
915638756 1:157204886-157204908 CAAGGAAGCTGGAGCAGAGAGGG - Intergenic
916300187 1:163265197-163265219 CATTGAAGTTGCAGCAGAGATGG - Intronic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
917365089 1:174222663-174222685 TATTGAAACAGGAGCAGTTAGGG + Intronic
918042595 1:180922220-180922242 CAGGGAGAAGGGAGCAGAGAAGG + Intronic
919849554 1:201663489-201663511 CATTGAACCCGGGACAGAGAGGG - Intronic
920244908 1:204580123-204580145 CAGTGAGAGGGGAGCACAGAGGG - Intergenic
920474314 1:206260006-206260028 CATTGTAAAGGGAGTAGGGAAGG + Intronic
921266731 1:213426673-213426695 TATTTAAACGGCAGCAGTGATGG - Intergenic
922324655 1:224516943-224516965 CACTGAAACAGAAGCAGAGCTGG - Intronic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
1063693445 10:8309207-8309229 CAATGAAACAGGATCAGAGTAGG + Intergenic
1065165805 10:22975872-22975894 CATAGAAAGGAGAACAGAGATGG - Intronic
1067274825 10:44824708-44824730 CATTAAAAGGTGAGCAGGGAGGG + Intergenic
1068377139 10:56195519-56195541 CATTGAAGCGTGAGTAGAGTGGG - Intergenic
1071300386 10:84252101-84252123 CAATGACACTGCAGCAGAGAGGG + Intronic
1073293946 10:102427204-102427226 CATTTAGAGGGGAGCAGAGAAGG - Intronic
1073856502 10:107681293-107681315 CAATAAAACGGGAGAAAAGAAGG + Intergenic
1074879527 10:117644449-117644471 CACTGAAACTGGAAAAGAGAAGG - Intergenic
1074940592 10:118232792-118232814 CTTTTAAACAGGAGGAGAGACGG + Intergenic
1075795580 10:125117205-125117227 CATTGTAACGGGGGCAGTGGGGG + Intronic
1076120764 10:127935068-127935090 CATGGAAACGGGAGGAGAGAAGG - Intronic
1078739219 11:14050986-14051008 CATTGCAGTGGGGGCAGAGATGG + Intronic
1079405215 11:20139027-20139049 CAATGAAACAGTAGCTGAGAAGG - Intergenic
1079908320 11:26277338-26277360 CATTGAAACTTTAGCATAGATGG + Intergenic
1080091492 11:28354095-28354117 CATTGGAGCAGGAGCTGAGAGGG + Intergenic
1080694857 11:34594650-34594672 CATTCAAAGGGTTGCAGAGAGGG - Intergenic
1084892263 11:72242443-72242465 CAGAGAGATGGGAGCAGAGATGG - Intronic
1087578159 11:100016209-100016231 CATAGATACGGGAGAAGGGAGGG + Intronic
1087712988 11:101575900-101575922 CTATGAAAAGGGAGAAGAGAAGG + Intronic
1090662552 11:128892076-128892098 CCTTCAAATGGGAGCAGGGAGGG + Intronic
1090863448 11:130674297-130674319 CATTGAAATGTGAGCAAACATGG + Intronic
1091026022 11:132141974-132141996 CATTGAAGCTGGAGGACAGAAGG + Intronic
1099924153 12:88997009-88997031 CATTGGAAAGGGAAAAGAGAGGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102015004 12:109642584-109642606 CAAGGAAAGGGGGGCAGAGAGGG - Intergenic
1102839729 12:116105907-116105929 CAATGAAATGTGAGCAGAAATGG + Intronic
1103438736 12:120947330-120947352 GATTGCAGCTGGAGCAGAGACGG + Intergenic
1103873337 12:124107047-124107069 CTTTGAAACGAAGGCAGAGAAGG - Intronic
1104158647 12:126157424-126157446 CATTGAATCTGGAAGAGAGAGGG + Intergenic
1104373196 12:128242572-128242594 CATTCAAACGGGACCAGAACTGG + Intergenic
1105600542 13:21882787-21882809 CATTGAAAGGCGAGAAGACAAGG - Intergenic
1106707951 13:32301551-32301573 CCTTGAATAGGCAGCAGAGATGG - Intergenic
1113525454 13:110971407-110971429 CATTCAAACCACAGCAGAGAAGG + Intergenic
1115905577 14:38199390-38199412 CACTGAAAGTGGAGCAGAGGCGG - Intergenic
1117372426 14:55090759-55090781 CATTAAAACAGAAGCAGAGGAGG - Intergenic
1117400831 14:55357283-55357305 AACTGAAATGGAAGCAGAGATGG + Intronic
1118148215 14:63163633-63163655 CATTGAAAGGGTAGGAGAAATGG + Intergenic
1118875956 14:69785059-69785081 CATTGATCCAGGGGCAGAGATGG + Intronic
1121920379 14:97875355-97875377 CATTAAAATGGCAGTAGAGATGG + Intergenic
1122213266 14:100187004-100187026 CATTGAAAGGAAAGCAGAGGGGG + Intergenic
1122411148 14:101526827-101526849 TATGGAGATGGGAGCAGAGATGG + Intergenic
1124955699 15:34359040-34359062 AATTCAAACAGGAGCAGAGATGG + Exonic
1127319384 15:57827737-57827759 CATTGAAAAGGGGGCAGTGTGGG - Intergenic
1129310806 15:74707624-74707646 AATTAAAACTGGAGCAGGGATGG + Intergenic
1130339277 15:82985713-82985735 GACTGAAGCTGGAGCAGAGAGGG + Intronic
1131521515 15:93119592-93119614 CTCTGAGAGGGGAGCAGAGATGG + Intergenic
1131679065 15:94702493-94702515 CAGTGCAAGGGGAGCAGTGAGGG - Intergenic
1131891243 15:96973665-96973687 CCTTAAAAAGGGAGAAGAGAAGG + Intergenic
1133019983 16:2963141-2963163 CATCGACACCGGGGCAGAGACGG + Intergenic
1135863843 16:26082106-26082128 CTTTGAAATGGGAGGAGAGGTGG + Intronic
1135963111 16:27014164-27014186 CAATGAAATGGGAAGAGAGATGG + Intergenic
1138149846 16:54646635-54646657 CAAGGAAACAGGGGCAGAGATGG + Intergenic
1138936194 16:61726949-61726971 CATCCAAATGGGAACAGAGAGGG - Intronic
1140768872 16:78185083-78185105 CAATGGAATGTGAGCAGAGATGG - Intronic
1141812903 16:86387934-86387956 CATGAAAACGGAAGCAGAGATGG - Intergenic
1141860611 16:86713638-86713660 CATGGAAAGGGGAGCAAACAGGG - Intergenic
1141917183 16:87107226-87107248 CATTGGAAACAGAGCAGAGAGGG - Intronic
1144536204 17:16094574-16094596 CATGGAAAGGGGAGGAGAGAGGG - Intronic
1148231210 17:45936201-45936223 CCTGGAAACAGGAGCAGAGGTGG - Intronic
1148831706 17:50437021-50437043 CGTTGATATGGGAGTAGAGATGG - Intronic
1148980666 17:51571673-51571695 CATTGCAAAGGGAGAAGACAAGG - Intergenic
1149435024 17:56626459-56626481 CACTGGAAAGGCAGCAGAGAGGG - Intergenic
1149459509 17:56816144-56816166 CAATGAAACAGGAGCATAAATGG - Intronic
1151874161 17:76857067-76857089 CATGGAGGCTGGAGCAGAGATGG + Intergenic
1155744413 18:29334344-29334366 AATTGATACTGGAGGAGAGAGGG + Intergenic
1156014813 18:32535722-32535744 CATAGATCCTGGAGCAGAGAAGG + Intergenic
1156159796 18:34345955-34345977 CATTGAATTGGAAGCTGAGATGG - Intergenic
1156518775 18:37703657-37703679 CAATGAAACGTGAGCAGGAATGG - Intergenic
1156654725 18:39271793-39271815 CAAGGAAACTGGAGCAGAGGTGG + Intergenic
1157027258 18:43860147-43860169 CTATGAAATGGGAGCAGGGAAGG - Intergenic
1157792176 18:50542411-50542433 CATTGAACAGTCAGCAGAGAGGG - Intergenic
1160180852 18:76635001-76635023 CATTGCACTGGGAGCAAAGAAGG + Intergenic
1161581422 19:5082976-5082998 CACTGACAGGGGAGCAGGGAGGG - Intronic
1162547861 19:11341683-11341705 CAATGAAATGTGAGCAGAGGTGG - Intronic
1163945669 19:20531214-20531236 CGTGGAAAGGGGAGGAGAGAGGG + Intergenic
1165052512 19:33150994-33151016 CTTTGAACCGGGAGCACAGCAGG - Intronic
1165150511 19:33757612-33757634 CATTCAGAAGGGAGCAGAAAGGG + Intronic
1166496486 19:43306541-43306563 CAATGACAGAGGAGCAGAGAGGG + Intergenic
1166516898 19:43453951-43453973 CCTTGCAAGGAGAGCAGAGATGG + Intergenic
1167633921 19:50642442-50642464 CATAGAGAGGGGAGCAGAGCTGG - Intronic
1168274803 19:55271716-55271738 CATTGAAATGGGGGCTGTGAGGG - Intronic
1168397745 19:56063436-56063458 CATTGCAATGGGAGCAGAAAAGG - Intergenic
925371180 2:3346714-3346736 AATTGAAAAGGGGGCAGAAAAGG + Intronic
925618714 2:5769164-5769186 CAGTGAAGAGGGAGGAGAGAGGG + Intergenic
925875671 2:8309350-8309372 CATTGACACAGCTGCAGAGACGG + Intergenic
928762534 2:34601696-34601718 TTTTGAAACAGGTGCAGAGAAGG + Intergenic
929875183 2:45790996-45791018 CTTTGAAAAGGGAACAGAGCAGG + Intronic
931729782 2:65142823-65142845 CAATGACAAGGGAGCAAAGATGG - Intergenic
931736176 2:65196859-65196881 AATTGCCATGGGAGCAGAGAAGG + Intergenic
934665162 2:96164559-96164581 CATTGCAAAGGGCTCAGAGAGGG - Intergenic
937265664 2:120613350-120613372 CTTTGAAGAGGGAGCAGGGAAGG - Intergenic
937309212 2:120891796-120891818 CACTGAAAAAGCAGCAGAGAGGG + Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
938322813 2:130376515-130376537 CATTGAGATGGAGGCAGAGATGG + Intergenic
939705498 2:145447646-145447668 CATTCAAACTGGAGCAACGAGGG - Intergenic
941954027 2:171186261-171186283 CATTGCTACAGGAGCACAGAGGG - Intronic
942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG + Intergenic
943272828 2:185829198-185829220 CATGGAAAAGGTAGCAAAGAGGG - Intronic
943789542 2:191916962-191916984 CATAGAAATGGGAACATAGAAGG + Intergenic
947437455 2:230084778-230084800 CAGAGAAACAGGAACAGAGAAGG + Intergenic
947966355 2:234284887-234284909 CATTCAAACAGCAGCAGTGATGG - Intergenic
948035257 2:234853183-234853205 CATAGGCACTGGAGCAGAGAGGG - Intergenic
948230257 2:236344086-236344108 CATTGAAAGGAGAGAAAAGAAGG + Intronic
1169806971 20:9569468-9569490 CTTGCAAAAGGGAGCAGAGAAGG + Intronic
1170903526 20:20489219-20489241 AATTCAAATGGGAGCAAAGAAGG + Intronic
1172682343 20:36726454-36726476 CATTGAAAGCGGAGCAAAAATGG - Intronic
1173113552 20:40218569-40218591 CACTGGAACAGAAGCAGAGAGGG - Intergenic
1176236600 20:64056462-64056484 GATGGAAAGGGGCGCAGAGACGG + Intronic
1178603981 21:34019127-34019149 CAGTGAGAAGGGAGCAGGGAGGG - Intergenic
1179902436 21:44401170-44401192 CGCTGGAACGGGAGCAGAGGCGG - Intronic
1181626934 22:24128710-24128732 CATTGGCACGGGGGCACAGATGG - Intronic
1182121891 22:27793082-27793104 CATTGAAATGGGAGCAGTCTCGG - Intronic
1184223171 22:43113630-43113652 CGTTGAGACGGGATCAGAAATGG - Intronic
1184535540 22:45084319-45084341 CATTGCAAAGGGTGCAGGGAAGG - Intergenic
1184593453 22:45500782-45500804 CAGTGAAAGGTGAGCAGAGGTGG - Intergenic
1185102836 22:48850677-48850699 GATGGAAAAGGGAGGAGAGAGGG + Intronic
949374243 3:3369211-3369233 CATTGAAGGTGGAGTAGAGAAGG - Intergenic
949545689 3:5070291-5070313 CAGTGAAATGTGAGCAGAAAGGG - Intergenic
949736719 3:7181045-7181067 CACTGAACCTGTAGCAGAGAGGG - Intronic
950633711 3:14300643-14300665 CTGTGAAACGGAGGCAGAGATGG - Intergenic
951360324 3:21717298-21717320 CATTCAAAGAGGAGCAGAAAAGG + Intronic
951528411 3:23676045-23676067 CATTGAAAAGGAAGCATACATGG + Intergenic
952573678 3:34748213-34748235 GAGTGAAACAGGAGGAGAGAAGG + Intergenic
953286415 3:41614660-41614682 CATTGCATGGGGAGTAGAGATGG - Intronic
953456170 3:43044107-43044129 CCTTGAGACGGGAGCAGGGAGGG + Intronic
953512352 3:43554949-43554971 CACTGACACTGTAGCAGAGAGGG + Intronic
953515610 3:43588397-43588419 CATTGAAATGGGAAAAAAGATGG + Intronic
959228324 3:103615331-103615353 CATTGTGAGGGAAGCAGAGAGGG - Intergenic
960812439 3:121637448-121637470 CATGGAAATGAGAGAAGAGAGGG - Intronic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
963127258 3:141827402-141827424 CATGGGAGCGGGAGGAGAGATGG + Intergenic
965669035 3:171127556-171127578 CTTTAAAAGGGGAGAAGAGAGGG - Intronic
966876598 3:184325656-184325678 GATTGAGAAGGGAGCAGTGAAGG + Intronic
967605636 3:191442361-191442383 CATTGAAAAGGGAGGAGATTTGG + Intergenic
972383003 4:38536507-38536529 GGTTGAAAAGGGAGAAGAGAAGG - Intergenic
974752311 4:66156588-66156610 CAGTGGAAGGGGAGCTGAGAAGG - Intergenic
975859796 4:78664460-78664482 CCTTGAAGCCGAAGCAGAGAGGG - Intergenic
977921379 4:102647059-102647081 CATAGAAAGTGGAACAGAGAAGG + Intronic
978237664 4:106478987-106479009 CATTCAAACCACAGCAGAGATGG - Intergenic
979694804 4:123600796-123600818 CAGTAAAACGGAAGCATAGATGG - Intergenic
980198270 4:129620235-129620257 CAATGGAACGTGAGCAAAGATGG + Intergenic
982002915 4:151037610-151037632 CAATGAAAAGGGACCAGAGGAGG + Intergenic
983177960 4:164614009-164614031 CAGTGAAATAGGTGCAGAGAGGG - Intergenic
986446541 5:7826026-7826048 CATTGAAACGGGGGCTAAGGAGG - Intronic
989137429 5:38168709-38168731 CCTTGAAACAGGTGCAGAGAAGG - Intergenic
989714925 5:44451747-44451769 GATTGAAAAGAGAACAGAGAAGG + Intergenic
990528532 5:56651972-56651994 CAGAGAAAAGGGAGTAGAGAAGG + Intergenic
991238860 5:64432716-64432738 CATTGGAAAGGTAGCAGGGAAGG + Intergenic
993792782 5:92227557-92227579 CATTGAAAGGGTAGAAAAGATGG - Intergenic
997741786 5:136261425-136261447 CATTGTAACGGGAGAAAAGGTGG - Intronic
999001560 5:147929332-147929354 CCATGAAAAGGGAGCACAGAAGG + Intergenic
999128387 5:149264016-149264038 GATGGAAAAGGGAGGAGAGAAGG + Intergenic
1001245598 5:170104122-170104144 CCATGAAAGAGGAGCAGAGAGGG + Intergenic
1001803524 5:174564076-174564098 CATTGAAACGGCCGCAGCGGAGG - Intergenic
1002691500 5:181053443-181053465 AAGGGAAACGGGAGCGGAGAGGG - Intronic
1004894331 6:20132221-20132243 CATTAAAACGTGAGAAGAGCTGG + Intronic
1006276939 6:33012081-33012103 CAATGGAATGTGAGCAGAGATGG - Intergenic
1007946793 6:45834248-45834270 CATTGAACAGGGAACAGTGAGGG + Intergenic
1008483476 6:52010383-52010405 CATGGAAACTGAGGCAGAGATGG - Exonic
1009055855 6:58334208-58334230 CCTTGAAAGAGGAGCAGAGGGGG + Intergenic
1009235321 6:61116393-61116415 CCTTGAAAGAGGAGCAGAGGGGG - Intergenic
1012259288 6:97069008-97069030 CATTGTAAGGGAAACAGAGAAGG + Intronic
1014323722 6:119965961-119965983 TAATGATACGGGAGCAGGGAAGG + Intergenic
1015599168 6:134895639-134895661 GATAGAAAGAGGAGCAGAGAGGG - Intergenic
1016418896 6:143863451-143863473 CATTTAAACTGGAGAAAAGAAGG + Exonic
1020210252 7:6153753-6153775 CAGTGCACCTGGAGCAGAGAGGG + Exonic
1020452666 7:8337632-8337654 CTTTGGACAGGGAGCAGAGATGG + Intergenic
1024083805 7:45877235-45877257 AATGGAAATGGGGGCAGAGAAGG - Intergenic
1024656759 7:51457575-51457597 CAGTGAAAAGGGAAAAGAGAGGG - Intergenic
1026161924 7:67877131-67877153 CAGTGAGAAGGGAGCAGTGAAGG + Intergenic
1027544704 7:79512901-79512923 CATTAAGATTGGAGCAGAGAGGG + Intergenic
1027602861 7:80260669-80260691 CATGTAAATGGGAGCAGAGATGG - Intergenic
1030019985 7:105264027-105264049 CATTGCAACGGGGGGAGAAAGGG + Intronic
1033566395 7:142582240-142582262 CATTGAAAGGGGCACAGAGTAGG - Intergenic
1036585231 8:10117428-10117450 CATAGAAAGGGGAGCAGGGCTGG + Intronic
1038729563 8:30114898-30114920 CAATGAAAGGGGAGTAGAGGAGG - Intronic
1041825585 8:62093215-62093237 CATTGGACCCTGAGCAGAGATGG - Intergenic
1042639878 8:70922085-70922107 CATGGAAACAAGAGCAGAGTTGG + Intergenic
1044861902 8:96532246-96532268 CATTGAACAGGGAGCAGTAAGGG + Intronic
1047137748 8:122100609-122100631 CATGGAAAGGGGAAGAGAGAGGG + Intergenic
1049455026 8:142682373-142682395 CATGGAAACAGCAGCAGAGAGGG - Exonic
1053488310 9:38478921-38478943 CATTGAAATGGGAGCTGATGAGG + Intergenic
1055669046 9:78582101-78582123 AATAGAAACAGGAGCAGTGACGG - Intergenic
1055890017 9:81114082-81114104 TATTGTTAGGGGAGCAGAGAGGG - Intergenic
1055951913 9:81737393-81737415 CAATGGACTGGGAGCAGAGATGG + Intergenic
1055981569 9:82008013-82008035 CATTGAAACAGCAGAAAAGAAGG + Intergenic
1056856347 9:90132866-90132888 CATTCAGAAAGGAGCAGAGATGG - Intergenic
1057126685 9:92621236-92621258 CATTCAGACAGTAGCAGAGAGGG + Intronic
1060525598 9:124319282-124319304 CATTAAAAAGTGAGCAGAGGAGG - Intronic
1186835609 X:13434425-13434447 CATTGAAACTGGAGAGGAAAGGG + Intergenic
1191081844 X:56520584-56520606 CATTGAAGAGGAAGCAGAGATGG - Intergenic
1191995578 X:67091752-67091774 CATTGAAGCTGTGGCAGAGAAGG + Intergenic
1193981851 X:88190538-88190560 AATGGAAACAGGAGAAGAGAAGG + Intergenic
1194122635 X:89978402-89978424 CTTTGAACAGGGAGCAGATAAGG - Intergenic
1199055350 X:143287493-143287515 AATATAAAGGGGAGCAGAGAGGG + Intergenic
1202136729 Y:21673235-21673257 CATAGAGACGAGAGAAGAGATGG + Intergenic