ID: 942455261

View in Genome Browser
Species Human (GRCh38)
Location 2:176133797-176133819
Sequence GTGGGAGCCCTGTGTATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942455252_942455261 22 Left 942455252 2:176133752-176133774 CCAGATACTTTTAGAACCCTGAA 0: 1
1: 0
2: 0
3: 21
4: 146
Right 942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 213
942455254_942455261 6 Left 942455254 2:176133768-176133790 CCCTGAAATAATGTTGGCAAGAC 0: 1
1: 0
2: 1
3: 8
4: 179
Right 942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 213
942455255_942455261 5 Left 942455255 2:176133769-176133791 CCTGAAATAATGTTGGCAAGACT 0: 1
1: 0
2: 2
3: 18
4: 168
Right 942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942455261 Original CRISPR GTGGGAGCCCTGTGTATGGG TGG Intergenic
900371630 1:2334749-2334771 GTGCGAGCCCTTTGGCTGGGAGG + Intronic
901465079 1:9416358-9416380 GTGAAAGCCATGTGTGTGGGTGG - Intergenic
902621715 1:17654697-17654719 GAGGTAGCCCTGTGGAAGGGAGG - Exonic
903283477 1:22263266-22263288 GTGGGAGCCTTGTTCATGGCTGG + Intergenic
904774908 1:32900833-32900855 GTGGGAGCCCCTTGTAAGGGTGG + Intronic
905741515 1:40374886-40374908 GTTGGAGGCCTATGTATGAGTGG + Intronic
906318795 1:44804278-44804300 GTGGGAGTTCTGTGGCTGGGAGG + Intronic
907540664 1:55214073-55214095 GTGGGAGGCCTGGGCAGGGGTGG - Intronic
912490269 1:110058985-110059007 GTGTGAGCCCTGTATCCGGGAGG - Intronic
912619530 1:111140596-111140618 GTGGGAGCCCAAGGTAGGGGTGG + Intronic
912952719 1:114131554-114131576 GTGTGTGCCTTGTGTATGAGGGG + Intronic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
914870895 1:151473056-151473078 GTGGGAGCCCGGGGTAGGGAGGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915124380 1:153653319-153653341 CTGGGAAAGCTGTGTATGGGAGG - Intergenic
915322263 1:155062373-155062395 GGAGGAGCCCTGGGCATGGGTGG + Intronic
916888851 1:169097069-169097091 GGGGAAGCCCTGTGTTTTGGAGG + Intergenic
918379193 1:183937596-183937618 TGGGGAGGCCTGTGGATGGGGGG - Exonic
919727880 1:200895519-200895541 GAGGGATCCCTGTGTTAGGGAGG + Intronic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920459490 1:206128367-206128389 CTGGGAGCCCTGTGGAGGGAGGG + Intergenic
921716199 1:218419188-218419210 GGGGGAGCCCTATGAATGAGGGG - Intronic
922917444 1:229270629-229270651 GAGGCCGCCCTGTGAATGGGAGG - Intergenic
1063974049 10:11401446-11401468 GTGGTGGCCCTGTGGCTGGGCGG - Intergenic
1064365923 10:14707753-14707775 TTGGGAGCCATGTTTATGGATGG - Intronic
1065536687 10:26721963-26721985 GAGGGGGCACTGTGTGTGGGGGG - Intronic
1065981210 10:30899656-30899678 CTGTGTGCCCTGTGTGTGGGGGG - Intronic
1069726403 10:70583029-70583051 GTGGAAGCCCTGGGTAGGTGGGG + Intergenic
1069755314 10:70771191-70771213 GTGGGAGGCCTGTGCTTGGTTGG - Intergenic
1069869987 10:71527209-71527231 GTGCGTGCCCTGTGCAGGGGCGG - Intronic
1070977241 10:80614966-80614988 CTGGGAGCCCTGTGGATGAGGGG + Intronic
1071174885 10:82914624-82914646 GTAGGATCCCTGTTTATGTGTGG + Intronic
1074134873 10:110617548-110617570 GTGGGAGGCCGCTGAATGGGTGG + Intergenic
1076029770 10:127147499-127147521 GAGAGAGCCCTCTGTATGGAAGG - Intronic
1076667529 10:132101719-132101741 GCTGGAGCCCTGTGTCTCGGGGG + Intergenic
1076785131 10:132745809-132745831 GTGGTGGCCCTGGGTATGGTGGG + Intronic
1076885110 10:133258609-133258631 GTGGGAGCCCTGTCTCTGAGGGG + Intergenic
1077882789 11:6364144-6364166 ATGGGAGGCCTGCCTATGGGAGG - Intergenic
1080505576 11:32909802-32909824 TTGGGAGTCGTGTGTATGGGGGG + Intronic
1081460749 11:43270358-43270380 TTGGGAGGCCTGAGCATGGGAGG + Intergenic
1081794337 11:45809278-45809300 GTGGGAGCTCTGGGCAAGGGAGG + Intronic
1082163207 11:48907211-48907233 GTGGGAGCACTGGCTATGGGTGG - Intergenic
1082169603 11:48987425-48987447 GTGGGAGTGCTGCCTATGGGTGG + Intergenic
1082234613 11:49808644-49808666 GTGGGAGTGCTGCCTATGGGTGG - Intergenic
1082658432 11:55879660-55879682 GTGGAAGTGCTGTCTATGGGTGG - Intergenic
1083198277 11:61103896-61103918 GTGTGAGTACTGTGTGTGGGGGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083751681 11:64764391-64764413 GTGGGAGCTCAGTGTGTGGGTGG - Intergenic
1083765374 11:64838974-64838996 GTGGGACCCCTGAGTCTGTGTGG - Intronic
1084482444 11:69429822-69429844 GTGGGAGCTCAGCGTGTGGGTGG + Intergenic
1085043796 11:73342156-73342178 GTGGGAGCACAGTCTAGGGGTGG + Intronic
1085043804 11:73342194-73342216 GTGGGAGCACAGTCTAGGGGTGG + Intronic
1085385783 11:76157389-76157411 GTGGGAGGCCTGGGAAGGGGAGG + Intergenic
1088169582 11:106980272-106980294 GTGGGAGCCCTGTCCCTGGCTGG - Intronic
1088376626 11:109148241-109148263 GTGAGAGCCTGGTGTATGGTGGG - Intergenic
1088843665 11:113647329-113647351 GGGCGAGGCCTGTGTGTGGGTGG - Intergenic
1091613480 12:2031397-2031419 GTGGCAGCACGGTGAATGGGGGG + Intronic
1092778660 12:11965488-11965510 CTGAGAGCCCTGTGTAGGAGGGG + Intergenic
1097198218 12:57256260-57256282 GTGGGAGACATGAGTATAGGAGG + Intronic
1097831649 12:64230837-64230859 GTGGGAGGCCTGTGTGTGTGTGG - Intergenic
1104110566 12:125700557-125700579 GAGGGAGCCCTGTGGAGGGCAGG + Intergenic
1104356291 12:128089834-128089856 GTGGGGAACCTGGGTATGGGGGG + Intergenic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1107133603 13:36920582-36920604 GTGGGAGCCCTTTGTCTGCGTGG + Intronic
1115447517 14:33508574-33508596 GTGTGAGCCCTGTGTGTGGTTGG - Intronic
1118157797 14:63257877-63257899 CAGGGAGCCCTGTGGATGAGGGG - Intronic
1121088797 14:91167211-91167233 GTCGGAGCTCTGGGTATGGTGGG - Exonic
1121328107 14:93033576-93033598 GTGGGAGCCTTGGGGCTGGGAGG + Intronic
1121584254 14:95052083-95052105 GGTGGAGCCCTGTGTTTGTGAGG - Intergenic
1122356334 14:101125207-101125229 GGGGGACCCCTGTGTAAGGAGGG - Intergenic
1122660381 14:103290899-103290921 CTTGGAGCCCTGTGTCTGTGGGG - Intergenic
1122757600 14:103994859-103994881 GTGGGAGACTTGTGCCTGGGAGG + Intronic
1128583773 15:68829249-68829271 GTGGAAGCCCTGTGTTTATGAGG + Intronic
1129382651 15:75177894-75177916 GTGGGAGGCCTGTGTCTGGCTGG + Intergenic
1130312267 15:82765939-82765961 GTGCGAGCCCTCAATATGGGGGG - Exonic
1131070324 15:89461765-89461787 GTGGGAGCTCTGTTTAGGGTGGG - Intergenic
1132710534 16:1264280-1264302 AAGGGAGCACTGTGAATGGGTGG + Intergenic
1136142191 16:28294674-28294696 TTGGGAGCCCTGAGCCTGGGTGG + Intronic
1136394215 16:29984061-29984083 GGGGGTGCCCTGTGCTTGGGTGG + Intronic
1137368873 16:47886530-47886552 GAGGGAGCCCTGTGCATCGCAGG - Intergenic
1137484683 16:48881413-48881435 CTGGGAGCCCTTTGTAAGGGTGG + Intergenic
1138418970 16:56886939-56886961 GTGGGGTCCCTGTGGGTGGGAGG - Exonic
1138547331 16:57727674-57727696 GTGGGAGCCCTGAGTAGAGGTGG - Intronic
1139432964 16:66920931-66920953 GAGGGAGCCATGGGCATGGGTGG + Intergenic
1140504767 16:75464389-75464411 GTGGGCGCCCCGAGTCTGGGCGG - Intronic
1140563344 16:76010412-76010434 ATGGGAGACGTGAGTATGGGTGG - Intergenic
1141493918 16:84393712-84393734 ATGGGAGGCCAGTGGATGGGAGG + Intronic
1141757051 16:85998225-85998247 GCAAGAGCCCTGTGTACGGGTGG - Intergenic
1142302205 16:89265347-89265369 GGGGGAACCCTGTGTCGGGGAGG + Intergenic
1142518652 17:490070-490092 GTGGGAGGCCTTTGGGTGGGTGG - Intergenic
1142621707 17:1169555-1169577 GGGGAAGGCCTGTGTCTGGGGGG - Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1144256772 17:13476168-13476190 TTGGGAGCCCTGAGTCTAGGTGG - Intergenic
1144653018 17:17018902-17018924 GTGTGAGCCCTGTCTAGGGAGGG - Intergenic
1145039828 17:19569437-19569459 GTGGGGGCCCTGGGGATGTGAGG + Intronic
1148903631 17:50897591-50897613 CTGAGAGCCCTGTGCATGGAGGG - Intergenic
1150493922 17:65592997-65593019 CAGGGAGCCCTGTGGGTGGGAGG - Intronic
1150633589 17:66897571-66897593 GCGACAGCCCTGTGTTTGGGGGG - Intergenic
1151891495 17:76953372-76953394 GGGGGTGGCCTGTGTATGTGGGG - Intergenic
1152100292 17:78297580-78297602 GTGGGGGTGCTGTGTTTGGGTGG - Intergenic
1152235997 17:79139221-79139243 GGGGGGGCCCTGTGTTTGTGGGG - Intronic
1152742452 17:82024264-82024286 GTGTGGCCCCTGTGTAAGGGGGG - Exonic
1152745313 17:82036124-82036146 GTGTGTGCCCTGGGTAGGGGTGG - Intronic
1152857878 17:82676438-82676460 GGGGGTGCCCTGTGTGGGGGGGG - Intronic
1157570900 18:48711605-48711627 GTGGTAGCCCTGTGTCATGGGGG - Exonic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1158675542 18:59514524-59514546 GTTGGAGCCCTGTGCGTGTGAGG + Intronic
1159500642 18:69264707-69264729 CTGGGAACCCTGTGAATGTGTGG + Intergenic
1160685839 19:436336-436358 GTGGGGGTCCTGTGGCTGGGGGG - Intronic
1160778983 19:869419-869441 GTGGGGGACCTGGGTCTGGGTGG + Intronic
1164514964 19:28926322-28926344 CTAGGAGCCCTGTGTAGGGTGGG - Intergenic
1164573728 19:29392844-29392866 GTGGCAGCCTTGAGTCTGGGTGG + Intergenic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1166275996 19:41754440-41754462 GTGGGAGCCCAGTGTCCAGGCGG - Intronic
1166395548 19:42437603-42437625 GTGGGAGCCCAGTGTCCAGGCGG + Intronic
1166889255 19:45980382-45980404 GTGGGAGCCATGGGGGTGGGGGG + Intergenic
1167377235 19:49118781-49118803 GTGGGCGGCCTCTGTGTGGGCGG + Exonic
1167490831 19:49792086-49792108 GTGGGAGCCCTGGGTATCCGGGG - Intronic
1167490861 19:49792160-49792182 GTGGGAGCCCTGGGTATCCGGGG - Intronic
1167490890 19:49792235-49792257 GTGGGAGCCCTGGGTATCCGGGG - Intronic
1167490918 19:49792310-49792332 GTGGGAGCCCTGGGTATCCGGGG - Intronic
1167490932 19:49792347-49792369 GTGGGAGCCCTGGGTATCCGGGG - Intronic
925931324 2:8710329-8710351 GTGGGGGCCTGGTGGATGGGGGG - Intergenic
926156150 2:10455027-10455049 GTGGGAGCCTGGAGGATGGGCGG - Intergenic
927467545 2:23348415-23348437 GGGGGAGCCCTGTGTCCTGGGGG + Intergenic
930066380 2:47330968-47330990 TTGGGGGCTCTGGGTATGGGTGG - Intergenic
932644698 2:73488265-73488287 GTGGGTGCCCAGTGTCTGGAGGG + Intronic
933645479 2:84809666-84809688 GAGGGAGCCCTGTCTAGGGCAGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934710777 2:96512574-96512596 GTGGGGGCACTGTGGGTGGGTGG + Intergenic
934768603 2:96894386-96894408 GTGGGAGGCCTGGGTATGTGTGG - Intronic
934925322 2:98378114-98378136 GTGGGAGACCTTTGATTGGGTGG + Intronic
936664552 2:114579253-114579275 GTGGGAGCCCTTTATAAGTGAGG + Intronic
938299766 2:130201614-130201636 GTTGGAGCCCTGAGGAAGGGGGG - Intergenic
938545913 2:132331227-132331249 GTGGTAGTGCTGTGTGTGGGAGG + Intergenic
940893045 2:159054041-159054063 GTGTGAGCCGTGTGTATGTTTGG + Intronic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
944106402 2:196083842-196083864 GTAGGAACTCTGTGTGTGGGGGG - Intergenic
944891592 2:204123007-204123029 CTGGAAACCCCGTGTATGGGGGG - Intergenic
947346847 2:229200590-229200612 GTGGGAGCTCAGTGGTTGGGAGG - Intronic
1169723196 20:8701262-8701284 GTTGGAGCCCAGTGGATGAGGGG - Intronic
1170534643 20:17327620-17327642 GAGGGTGCACTGTCTATGGGAGG - Intronic
1171874775 20:30563960-30563982 GTGGTAGTGCTGTGTGTGGGAGG + Intergenic
1172870173 20:38130883-38130905 GTGGCAGATCTGTGCATGGGTGG + Intronic
1173546644 20:43903031-43903053 TGGGGAGCCCTGTGTATAGCAGG + Intergenic
1179005630 21:37511627-37511649 TTGGGAGCCCTGTTTATGCCAGG - Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182742203 22:32576149-32576171 TTGGGAGCCCTGTGGATATGTGG - Intronic
1183960955 22:41411594-41411616 GTGTGAGCCCTGTGGAGGAGGGG - Intergenic
1184467629 22:44678123-44678145 ATGGGAACCCTGTGGATGGTCGG + Intronic
1184525654 22:45020888-45020910 GTGGGAGCCCTATGTGAGGTGGG + Intergenic
1184850835 22:47119348-47119370 CTGGGAGCCATGTGTCCGGGTGG - Intronic
951551845 3:23882612-23882634 GTGGGAGCCCACTGCAGGGGTGG + Intronic
953730380 3:45442273-45442295 GGGGGAACCCTGTGTCTGTGGGG - Intronic
955088104 3:55722383-55722405 GTGGAAGCCCTGTGCATGGAGGG - Intronic
961043322 3:123692688-123692710 ATGGGACCCCTGTGTATGGGTGG + Intronic
961616776 3:128188795-128188817 CTGGGAGCCCTGTGCCTGAGGGG + Intronic
963785330 3:149528677-149528699 GGAGGAGCCCTGTGCCTGGGAGG + Intronic
967284862 3:187859179-187859201 GTGGAAGCCCTGTGCCTGGGTGG + Intergenic
968460412 4:721861-721883 GTGGGAGACTGGTGGATGGGTGG + Intronic
968474509 4:796950-796972 GTGGGGGTCCTGTGTCTGTGGGG - Intronic
968855036 4:3113747-3113769 GGGGGAGTCCTGTGGCTGGGGGG + Intronic
969409011 4:7015644-7015666 CTGGGAGACCTGTGTGTGGAAGG + Intronic
970401185 4:15719329-15719351 GTGGGATCCCTGTGCATGACAGG + Intronic
971371962 4:26027190-26027212 GAGGGAGCCCTGTGGGTGGTAGG + Intergenic
972068522 4:34983706-34983728 GTGAGAACCCTGTCTCTGGGGGG + Intergenic
973045422 4:45530733-45530755 GTGGGAGCCCACTGCGTGGGGGG - Intergenic
974485116 4:62494484-62494506 GTGGGGGCTCTGTGTGTGGGGGG - Intergenic
975764085 4:77649017-77649039 TTGGGAGCCCTGTTTATAGGTGG + Intergenic
979481771 4:121227523-121227545 GGGGTTTCCCTGTGTATGGGTGG - Intergenic
982831455 4:160066128-160066150 GTAGGAGCCCTTTGTATGTCAGG + Intergenic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
985535154 5:460533-460555 CTGTGACCCCTGTGGATGGGCGG - Intronic
985931197 5:3059054-3059076 GTGGGAGCTGTGTGTAAGGATGG + Intergenic
986824388 5:11504929-11504951 GTGGGGTCTCTGTGGATGGGAGG - Intronic
997158162 5:131580116-131580138 GTGGGAGCCCACTGTGGGGGGGG + Intronic
997476664 5:134146431-134146453 GTGGGGGCCCTGGGGTTGGGAGG - Exonic
997766435 5:136508300-136508322 GTGAGAGCCCAGTGACTGGGAGG + Intergenic
998519776 5:142789715-142789737 GTGGCAGGAGTGTGTATGGGTGG - Intronic
999769923 5:154767811-154767833 TTTGGAGCCCAGTGTAGGGGTGG + Intronic
1001837306 5:174843155-174843177 GTGGGGGCCATGGGAATGGGAGG + Intergenic
1001917010 5:175570133-175570155 ATGGGGGCCCTGTTTATAGGTGG - Intergenic
1002041020 5:176514294-176514316 TTGGGAGCCCTGAATGTGGGTGG + Intergenic
1002058872 5:176614452-176614474 GTGTGTGCTCTGTGTGTGGGGGG + Intergenic
1002451531 5:179321663-179321685 TTGGGAGCGCTCTGTATGGAGGG - Intronic
1004947349 6:20630266-20630288 GAGGAAGGCCTCTGTATGGGAGG - Intronic
1006847530 6:37072889-37072911 GTGAGGGCCGTGTGTATGTGAGG - Intergenic
1014169989 6:118267827-118267849 GGGGGAGCCCTGAGTCAGGGTGG + Intronic
1014755241 6:125295733-125295755 GTGGTATGCCTGTGTCTGGGAGG - Intronic
1018022910 6:159778770-159778792 GTTGCAGCCCTGTGCATTGGGGG + Exonic
1018314986 6:162547927-162547949 GTGGGAGACCAGTGGATGTGAGG - Intronic
1018812575 6:167308457-167308479 GTGGGGGCCCTGTGGATGTGGGG + Intronic
1018925607 6:168204658-168204680 GTGGGAGGGGTGTGTAGGGGGGG - Intergenic
1019257883 7:63300-63322 CTGGGAGCCCTCTGTGTGTGGGG + Intergenic
1019994753 7:4717016-4717038 GTGGGAGGCGTGTGGCTGGGAGG + Intronic
1021284087 7:18757731-18757753 GTGTGTGCTCTGTGTGTGGGTGG + Intronic
1021743422 7:23711746-23711768 GTGGAAGTCCTTTTTATGGGAGG + Intronic
1022195478 7:28062492-28062514 GTGGGAGGCCTGTGGAAAGGTGG - Intronic
1026672948 7:72405490-72405512 GTGGGAGCCATGTGGGTGTGGGG - Intronic
1030064438 7:105648607-105648629 GCGGGATCTGTGTGTATGGGAGG - Intronic
1033472872 7:141665115-141665137 CCAGGAGCCCTGTGTCTGGGAGG + Intronic
1033707047 7:143900367-143900389 GTGGGAGCCTTCTCTCTGGGGGG + Intronic
1035056869 7:156041628-156041650 GAGCGTGCCCTGTGTCTGGGGGG - Intergenic
1035650035 8:1257225-1257247 CTGGGAGCCGTGTGTGTGGCAGG - Intergenic
1037917525 8:22781609-22781631 GTGGGAGGCCTGGGTACAGGGGG - Intronic
1037973512 8:23192159-23192181 GTGGGCTCTCTGTGGATGGGAGG - Intronic
1038495956 8:28002963-28002985 GGGGAAGGCATGTGTATGGGTGG - Intergenic
1038570138 8:28654951-28654973 GTGGCAGACCTTTGTTTGGGAGG + Intronic
1039508660 8:38071354-38071376 GTGTGAGCCCTGTGCATGGCTGG - Intergenic
1040056905 8:43066738-43066760 TTGGAAGCCCTGTGTGTGGCAGG + Intronic
1040635677 8:49270466-49270488 GTGGCTGCTCTGGGTATGGGGGG + Intergenic
1042350992 8:67777487-67777509 GTGTGAGCCCAGTGTATGCCTGG + Intergenic
1044538029 8:93379951-93379973 ATGGGACCACTGTGTATGTGTGG - Intergenic
1047067629 8:121303442-121303464 GTGGGAGCAGTGTGTGTAGGGGG + Intergenic
1048134182 8:131730033-131730055 ATAGGAGCCCTGTTGATGGGAGG - Intergenic
1048806757 8:138248256-138248278 GTGGGAACCCAGTGTAGGGTAGG - Intronic
1048860298 8:138719887-138719909 GCGGGAGCCCTGTGGGTGGAGGG + Intronic
1049392036 8:142376722-142376744 CTGGGAGTCCCGTGTCTGGGTGG - Intronic
1049508436 8:143015838-143015860 GAGGGAGTCCTGTGTGAGGGGGG + Intergenic
1055373628 9:75625637-75625659 CTGGGAGCTCTGTGTCAGGGAGG + Intergenic
1055543311 9:77338577-77338599 ATGGCAACCCTGTGTCTGGGAGG - Intronic
1057217139 9:93235318-93235340 GTGTGAGCACTGGGGATGGGTGG - Intronic
1059905537 9:118981032-118981054 GTGGAACCCATGGGTATGGGGGG - Intergenic
1060776160 9:126376466-126376488 GCTGGAGCCCTGTGGGTGGGGGG + Intronic
1060777208 9:126383761-126383783 GTGGCAGCCCTGTGTGAGGAGGG + Intronic
1060911206 9:127352540-127352562 GTGGGAGCCCAGGGTAGAGGAGG + Intronic
1062407158 9:136402325-136402347 GAGGGAGCCCTGAGCATCGGCGG + Exonic
1062595738 9:137298386-137298408 GTGGCAGCCATGTGCCTGGGAGG + Intergenic
1062624499 9:137436684-137436706 GTGGGTGCCCTGGACATGGGAGG - Exonic
1186573371 X:10739246-10739268 GTGTGTGTCCTGTGTGTGGGTGG + Intronic
1187377040 X:18764402-18764424 GTGGGTGTCCTGGGGATGGGTGG + Intronic
1188977537 X:36692941-36692963 GTGCGAGCACTGTTTGTGGGAGG + Intergenic
1190113328 X:47609400-47609422 GGGGGAGCCCTGGGGCTGGGAGG - Intronic
1190298378 X:49042019-49042041 GTGTGAGCCCTGGGTGGGGGGGG - Intronic
1199471539 X:148200843-148200865 TTGGGAGCCTTGTATATGGTAGG - Intergenic
1199758423 X:150886767-150886789 GTGGGTGTCCTGTGTGTTGGAGG - Intronic
1200032890 X:153310750-153310772 GTGGTAGCCCTGTGTCTCTGGGG + Intergenic
1200050370 X:153426364-153426386 GTAGGATCCCATTGTATGGGTGG + Intergenic
1200152671 X:153958926-153958948 GTGGGAGCCCTCTGTGTCTGGGG - Intronic