ID: 942455663

View in Genome Browser
Species Human (GRCh38)
Location 2:176136718-176136740
Sequence GGCGATGCGGACCGAGTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 40}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942455663_942455675 11 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455675 2:176136752-176136774 AGCTGGTGGGGAGCCCGGCGAGG 0: 1
1: 0
2: 4
3: 27
4: 299
942455663_942455682 25 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455682 2:176136766-176136788 CCGGCGAGGGAGGGCCTGGAAGG 0: 1
1: 0
2: 1
3: 36
4: 300
942455663_942455669 -2 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455669 2:176136739-176136761 CCGCCACCTCCGGAGCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 190
942455663_942455670 -1 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455670 2:176136740-176136762 CGCCACCTCCGGAGCTGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 160
942455663_942455676 12 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455676 2:176136753-176136775 GCTGGTGGGGAGCCCGGCGAGGG 0: 1
1: 0
2: 1
3: 20
4: 263
942455663_942455683 26 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455683 2:176136767-176136789 CGGCGAGGGAGGGCCTGGAAGGG 0: 1
1: 0
2: 1
3: 37
4: 423
942455663_942455673 6 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455673 2:176136747-176136769 TCCGGAGCTGGTGGGGAGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 297
942455663_942455679 21 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455679 2:176136762-176136784 GAGCCCGGCGAGGGAGGGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 504
942455663_942455667 -3 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455667 2:176136738-176136760 GCCGCCACCTCCGGAGCTGGTGG 0: 1
1: 1
2: 3
3: 33
4: 283
942455663_942455684 27 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455684 2:176136768-176136790 GGCGAGGGAGGGCCTGGAAGGGG 0: 1
1: 0
2: 6
3: 67
4: 663
942455663_942455677 15 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455677 2:176136756-176136778 GGTGGGGAGCCCGGCGAGGGAGG 0: 1
1: 0
2: 4
3: 51
4: 634
942455663_942455678 16 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455678 2:176136757-176136779 GTGGGGAGCCCGGCGAGGGAGGG 0: 1
1: 0
2: 1
3: 47
4: 502
942455663_942455666 -6 Left 942455663 2:176136718-176136740 CCGCTCACTCGGTCCGCATCGCC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 942455666 2:176136735-176136757 ATCGCCGCCACCTCCGGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942455663 Original CRISPR GGCGATGCGGACCGAGTGAG CGG (reversed) Intergenic