ID: 942458781

View in Genome Browser
Species Human (GRCh38)
Location 2:176155580-176155602
Sequence CTGTGGGCCCAAATGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942458781_942458796 18 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458796 2:176155621-176155643 GTAGGGCCCCGTAACCACTTAGG 0: 1
1: 0
2: 0
3: 2
4: 16
942458781_942458790 -6 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458790 2:176155597-176155619 CCACAGGAGTGGGCCAGGGAAGG 0: 1
1: 0
2: 4
3: 58
4: 528
942458781_942458803 28 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458803 2:176155631-176155653 GTAACCACTTAGGGCAGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 185
942458781_942458787 -10 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458787 2:176155593-176155615 GGGCCCACAGGAGTGGGCCAGGG 0: 1
1: 0
2: 3
3: 62
4: 631
942458781_942458792 -4 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458792 2:176155599-176155621 ACAGGAGTGGGCCAGGGAAGGGG 0: 1
1: 2
2: 6
3: 59
4: 691
942458781_942458798 23 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458798 2:176155626-176155648 GCCCCGTAACCACTTAGGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 50
942458781_942458791 -5 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458791 2:176155598-176155620 CACAGGAGTGGGCCAGGGAAGGG 0: 1
1: 0
2: 9
3: 44
4: 544
942458781_942458793 0 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458793 2:176155603-176155625 GAGTGGGCCAGGGAAGGGGTAGG 0: 1
1: 0
2: 10
3: 131
4: 1064
942458781_942458800 24 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458800 2:176155627-176155649 CCCCGTAACCACTTAGGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 58
942458781_942458794 1 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458794 2:176155604-176155626 AGTGGGCCAGGGAAGGGGTAGGG 0: 1
1: 0
2: 3
3: 54
4: 644
942458781_942458797 19 Left 942458781 2:176155580-176155602 CCAGCATCCATTTGGGCCCACAG 0: 1
1: 0
2: 0
3: 9
4: 153
Right 942458797 2:176155622-176155644 TAGGGCCCCGTAACCACTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942458781 Original CRISPR CTGTGGGCCCAAATGGATGC TGG (reversed) Intronic
900683405 1:3931508-3931530 CTGTGGGCTACACTGGATGCAGG + Intergenic
900942630 1:5810868-5810890 CTGTGGGCCAAAAGCAATGCAGG - Intergenic
901458464 1:9377294-9377316 CTTTGGCCCCAAAGGGAGGCAGG - Intergenic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
905357554 1:37395337-37395359 CTGGGAGCCCAAGTGGCTGCGGG - Intergenic
907185580 1:52606799-52606821 CTGTTGGCCAAACTGGTTGCAGG - Exonic
911259781 1:95671871-95671893 CAGTGGTCTCAAATGGATGCTGG - Intergenic
915332622 1:155122797-155122819 CTGTAAGCCCAAATGTAAGCCGG + Intergenic
915339341 1:155167685-155167707 CTCTGGGCCTAAAGGGAGGCTGG - Intergenic
916142681 1:161712967-161712989 CTGTGGGGCCCAATGGCAGCAGG - Intronic
917485700 1:175452638-175452660 CTGTGGGGCCTAGTGGATGAGGG + Intronic
920198669 1:204245807-204245829 CTGCTGGCCCAAAGGGATGTGGG - Intronic
920865331 1:209747753-209747775 CTGACGGCCCAAAGGGAGGCCGG - Intergenic
922540235 1:226413744-226413766 CTGTGGGTCCAAATTCATCCTGG + Intergenic
922659363 1:227416293-227416315 CTGTGGCACCAAAAGGATTCTGG - Intergenic
923725148 1:236499258-236499280 CTGTTCTCCCAAGTGGATGCTGG - Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1070319960 10:75347362-75347384 CTGCGGGCCCAGATGGATGTGGG - Intergenic
1071900222 10:90112848-90112870 CTCTCAGCCCAAATGTATGCAGG - Intergenic
1075283582 10:121162741-121162763 CTTTGTGCCAAAATGGATGGTGG - Intergenic
1076354749 10:129843431-129843453 CTGTGAGCCCAACCGGATGGAGG - Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1079315182 11:19401796-19401818 CTGTGGCCCCAAAGGAGTGCAGG - Intronic
1083336510 11:61924798-61924820 CTTTGGGCCCAGATGGGTGTGGG + Intergenic
1084219319 11:67667730-67667752 CTGTGAGCCCCCATGGGTGCAGG - Intronic
1084426766 11:69088294-69088316 CTGTGGTCCCCAAGGGCTGCCGG - Exonic
1085779918 11:79398816-79398838 CTGGGGGCCCAAGTAGAGGCTGG + Intronic
1089120874 11:116134048-116134070 CTTCGGGGCCAAATGGATACTGG - Intergenic
1090383055 11:126340064-126340086 CCGTGGGCTCAAATGCATTCAGG - Intronic
1091470823 12:725357-725379 CTGTGGGGCAAAATGAATACAGG - Intergenic
1093514145 12:19965812-19965834 TTGTGGGCCCAGATAGATGGTGG + Intergenic
1096521968 12:52189590-52189612 GTGAGGGCCCACATGGAAGCAGG - Intronic
1097206433 12:57325449-57325471 CTCAGGGTCCAAATGGCTGCTGG - Intronic
1099455166 12:82854397-82854419 TTGTGGGCCAAGATGGCTGCTGG + Intronic
1102401644 12:112634693-112634715 CTGTGCCCCCAAATTGTTGCAGG - Intronic
1103627483 12:122231082-122231104 CTGTGGGACCAGTTGGATGTTGG + Exonic
1104290100 12:127458508-127458530 GTGTGGCCCCAAATAAATGCTGG - Intergenic
1104318092 12:127722912-127722934 CTCAGGGCCCAAATTGATACAGG - Intergenic
1105209155 13:18247696-18247718 TTGTGGGCCCAATGGGAGGCAGG + Intergenic
1106502523 13:30342683-30342705 CTGTGAGCCCAAAATTATGCTGG + Intergenic
1106809465 13:33345954-33345976 CTGAGGGCCAAACTGGAGGCTGG - Intronic
1110746612 13:79061158-79061180 CTTTGGGCTCAAATGCATTCTGG - Intergenic
1111878178 13:93921827-93921849 CTGTGGCCCTAAATGGGTACAGG - Intronic
1113225448 13:108154414-108154436 CTGTGGGCCAACAGGGAGGCTGG - Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1121690437 14:95874551-95874573 CTGTGTGCCAAATTGGCTGCCGG - Intergenic
1122852645 14:104545367-104545389 CTGATGGCCCAAGGGGATGCGGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1130192622 15:81750901-81750923 CTCTGGGCCAAAGTGGCTGCAGG - Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131536645 15:93242521-93242543 CTCATGGACCAAATGGATGCTGG + Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1134244984 16:12533186-12533208 CTGTGGCCTCAGATGGCTGCTGG - Intronic
1134470699 16:14522702-14522724 CTGTGTGCCCATCTTGATGCAGG - Intronic
1138123813 16:54422505-54422527 CTGTGGGCCCACAAAGCTGCAGG - Intergenic
1141208063 16:81949270-81949292 CTGAGGGCCCACTTGGTTGCAGG + Intronic
1143417371 17:6759574-6759596 CTGTGAGCCAAAGTGGATGTGGG + Intronic
1150009845 17:61493430-61493452 CTGTGGACCTGAATGTATGCGGG + Intergenic
1151556950 17:74851506-74851528 CTGTGGGCACAAGAGGAGGCGGG + Intronic
1152205066 17:78970223-78970245 CTGGGGGACCCATTGGATGCCGG - Intergenic
1154346767 18:13549061-13549083 CTTTTGTCACAAATGGATGCTGG + Intronic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1157859271 18:51126032-51126054 CTGTGGCCCTAAATGGAAACAGG - Intergenic
1161218393 19:3106150-3106172 CTTTGGGGCCACATGGCTGCCGG + Intronic
1161614994 19:5265150-5265172 CTGTGGGCCCATGTCGATGTTGG + Exonic
1166117106 19:40662964-40662986 CTGTGGGGCCACGTGGTTGCCGG - Intergenic
1166740883 19:45114212-45114234 CTGTGGCCCCAGGTGGATTCTGG - Intronic
928050982 2:27995161-27995183 CTGTGGGCCAGAATTGGTGCAGG + Intronic
930547149 2:52782788-52782810 CTGTGGACCCAAACTGATTCTGG + Intergenic
930841846 2:55856021-55856043 AAGTGGGCTCAGATGGATGCAGG - Intergenic
931190762 2:59998048-59998070 CTGAGGGCTCAAATGGATTCTGG - Intergenic
936827460 2:116599753-116599775 CTGTGGACCCAAATGGAGTGAGG - Intergenic
937267731 2:120627273-120627295 CTGGGGTCCAAAATGGCTGCTGG + Intergenic
938342905 2:130547301-130547323 CTGTGTGCCCAAAGGGAGTCAGG - Intronic
938346928 2:130573421-130573443 CTGTGTGCCCAAAGGGAGTCAGG + Intronic
940122279 2:150280128-150280150 CTGTTCCCACAAATGGATGCAGG - Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
942458781 2:176155580-176155602 CTGTGGGCCCAAATGGATGCTGG - Intronic
942753090 2:179309922-179309944 CTGTGGGCCAAAATAGATTGTGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948006195 2:234609805-234609827 CTGTGGGCAGCAATGGCTGCTGG + Intergenic
948176538 2:235948017-235948039 CTGTGTGCCCACCTGAATGCAGG + Intronic
1169803175 20:9532384-9532406 CTGTGGGCACAAGAGGATGTTGG + Intergenic
1170161210 20:13313116-13313138 CTGTGGGCAGACCTGGATGCGGG - Intergenic
1171290328 20:23979409-23979431 TTGTGGGCCCAATGGGAGGCAGG + Intergenic
1172603896 20:36201724-36201746 CTGTGGCCCTTCATGGATGCTGG + Intronic
1173413608 20:42837197-42837219 CTGTGGGCTCCAGTGGCTGCTGG - Intronic
1175404253 20:58716590-58716612 CTGTGGGGGCACATGGATTCTGG - Intronic
1176056446 20:63151510-63151532 CCTTGGGCCCAGCTGGATGCAGG + Intergenic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1179286918 21:39985363-39985385 CTGTGGGCCCCAGATGATGCAGG - Intergenic
1180060110 21:45380659-45380681 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180060130 21:45380793-45380815 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180131549 21:45830081-45830103 CTGTGGCCCCAAGGGGATGGAGG + Intronic
1180767100 22:18351601-18351623 TTGTGGGCCCAATGGGAGGCAGG - Intergenic
1180779211 22:18510778-18510800 TTGTGGGCCCAATGGGAGGCAGG + Intergenic
1180811930 22:18768098-18768120 TTGTGGGCCCAATGGGAGGCAGG + Intergenic
1181023132 22:20113744-20113766 GACTGGGCCCAATTGGATGCGGG - Exonic
1181198085 22:21202342-21202364 TTGTGGGCCCAATGGGAGGCAGG + Intergenic
1181401660 22:22653462-22653484 TTGTGGGCCCAATGGGAGGCAGG - Intergenic
1181703618 22:24634559-24634581 TTGTGGGCCCAATGGGAGGCAGG - Intergenic
1182280356 22:29214761-29214783 ATTTGGGCCCAAATGGCTGGGGG - Intronic
1184106952 22:42373339-42373361 ATGTGGGCCCAGATGGGTGCCGG + Intergenic
1184328653 22:43811777-43811799 CTGTGGGCACAAATGAAATCAGG + Intronic
1184894402 22:47398817-47398839 TTGTTGTCACAAATGGATGCAGG - Intergenic
1203228722 22_KI270731v1_random:92495-92517 TTGTGGGCCCAATGGGAGGCAGG - Intergenic
954117638 3:48475994-48476016 ATGTGGGCCCATCTGGATCCAGG + Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
960867630 3:122218128-122218150 AGGGGGGCCCAAGTGGATGCAGG + Intronic
965682458 3:171265499-171265521 CTGTCTGCCCAAATTAATGCAGG - Intronic
969296239 4:6271848-6271870 CTGAGGGCCCGAAAGAATGCCGG - Intronic
970507402 4:16745275-16745297 CTGTTGGTCCAAATGAATGCAGG + Intronic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
977412889 4:96690352-96690374 CTGGGGCCCACAATGGATGCCGG + Intergenic
977830273 4:101582634-101582656 CTGTGGGCATACATGGATTCTGG + Intronic
978958272 4:114641522-114641544 CTGTAAACCCTAATGGATGCTGG + Intronic
984242927 4:177239414-177239436 CTGTGAGCTCAAATGCATGAAGG - Intergenic
986236418 5:5914653-5914675 CTCTGGGACAAGATGGATGCTGG + Intergenic
989311756 5:40026887-40026909 CTTTAAGCCCAAATGGTTGCTGG - Intergenic
990453611 5:55961373-55961395 CTCTAGGCCCAAAGGGATGAGGG + Intronic
992176068 5:74149795-74149817 TTGTGATCCCAAATGGCTGCTGG - Intergenic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
998373770 5:141678349-141678371 GTGTGTGCCCAAAGGGATCCAGG - Intronic
999288272 5:150407063-150407085 CAGTGGGCCCAGCTGGGTGCAGG + Intronic
1000769206 5:165330716-165330738 CTGTGGATCCATATGGATGCTGG + Intergenic
1001435592 5:171696792-171696814 CTGTGGGGCCACATGGAACCTGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1002648102 5:180672232-180672254 CTCTGGGCCCACGTGGAGGCTGG + Intergenic
1007540762 6:42641633-42641655 CTGTGTGCCCAAGTACATGCCGG + Exonic
1009697987 6:67134432-67134454 CTGTGTGCCCAAATGGAGTGTGG + Intergenic
1017053129 6:150412699-150412721 ATGTGAGCCCAAGTGGATGATGG + Intergenic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1018699069 6:166412709-166412731 CTGTGAGCCCACGAGGATGCTGG + Exonic
1030438286 7:109552649-109552671 TTGTGGGCCCAAATGCCTGTAGG - Intergenic
1033848818 7:145469403-145469425 CCGTGGCCCCATATGGAGGCTGG + Intergenic
1034825239 7:154256395-154256417 CTGTGGAACCAAATGGAAACTGG + Intronic
1035066042 7:156105689-156105711 CTGTGGAGCCAAAATGATGCGGG - Intergenic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1037567491 8:20130067-20130089 CTGTGGCCACAAGTGGGTGCTGG + Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1049209685 8:141379931-141379953 ATGTGAGCCCAACTGGAGGCTGG - Intergenic
1052359221 9:27536370-27536392 CTTTGGGCACTACTGGATGCAGG - Intergenic
1052806665 9:33019713-33019735 CTGGGGGCCCAAAGTGCTGCAGG + Intronic
1052837040 9:33258604-33258626 CTGTGAGCATAAATGGATGCTGG + Intronic
1055845638 9:80559181-80559203 CTGAGGGTCATAATGGATGCTGG - Intergenic
1056457970 9:86781620-86781642 CTGTGGGCCCAAATGCAGATGGG - Intergenic
1056885960 9:90444097-90444119 CTGTGGTCACACATGGAAGCTGG - Intergenic
1057605482 9:96495494-96495516 CTGGCGGCCCACATGGATACTGG + Intronic
1057835427 9:98440797-98440819 CTGTGGGCCCTGATGGACACTGG - Intronic
1060315190 9:122503316-122503338 CTGGGGGACCAAATGGTTACTGG - Intergenic
1061160871 9:128892988-128893010 CTGTGGGCCCACATGGGGTCTGG + Intronic
1061377623 9:130235591-130235613 CTGTGGGCCCACCGGCATGCTGG - Exonic
1061681787 9:132246067-132246089 CTGTGGGCGCCAAAGGAGGCAGG - Intergenic
1061857268 9:133449197-133449219 CTGTGGGTGCACATGGTTGCTGG + Intronic
1186206525 X:7206106-7206128 CTGGGGGCCCAAAACGATGAAGG - Intergenic
1186505899 X:10091837-10091859 TTGTGTGCCCACATGAATGCTGG - Intronic
1190096284 X:47483257-47483279 CTGTGGGCGCAGAGGGTTGCGGG + Intergenic
1197684843 X:129427980-129428002 CTCAGGGCCCACATGGATCCAGG + Intergenic
1198835766 X:140803333-140803355 CTCTGGGCGCCAATGGAAGCTGG - Intergenic
1199528249 X:148816788-148816810 CTGTGTGCCCAAATGCTTTCAGG - Intronic
1201754400 Y:17470299-17470321 CTGTGGCCCCTAATGGACACAGG - Intergenic
1201847152 Y:18435686-18435708 CTGTGGCCCCTAATGGACACAGG + Intergenic