ID: 942461599

View in Genome Browser
Species Human (GRCh38)
Location 2:176172118-176172140
Sequence AGTCCACGCTGGCCGACGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 25}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942461599_942461604 17 Left 942461599 2:176172118-176172140 CCCGTCGTCGGCCAGCGTGGACT 0: 1
1: 0
2: 0
3: 5
4: 25
Right 942461604 2:176172158-176172180 ATTCCAGGCAACCACCACCATGG 0: 1
1: 0
2: 85
3: 441
4: 1217
942461599_942461602 2 Left 942461599 2:176172118-176172140 CCCGTCGTCGGCCAGCGTGGACT 0: 1
1: 0
2: 0
3: 5
4: 25
Right 942461602 2:176172143-176172165 AGTTGCGCCGCGCAGATTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942461599 Original CRISPR AGTCCACGCTGGCCGACGAC GGG (reversed) Exonic
900158297 1:1212211-1212233 GGTCCACGCTGGCCAGCCACAGG + Intronic
900175001 1:1287721-1287743 TGTCCACGCTGGCCGGCATCAGG + Exonic
903486293 1:23691635-23691657 AGGCGACGCTGGCTGAAGACCGG - Intergenic
903772844 1:25774897-25774919 AGTGCAGGCTGGCAGACGACTGG - Intronic
924775378 1:247112027-247112049 AGTCCACGCGGGCCGCCGAGAGG - Exonic
1062909916 10:1205756-1205778 AGAACACGCTGGCCCACGACAGG - Intronic
1073426511 10:103458506-103458528 TGTCCATGCTGGCCGAAGAGTGG - Exonic
1082710318 11:56547059-56547081 AGACCACTCTGGCCCACCACAGG + Intergenic
1092767914 12:11869826-11869848 AGTCCAGGCTCTCCGAGGACGGG + Exonic
1119586110 14:75837205-75837227 AGTTCATGCTGGCTGTCGACAGG + Intronic
1130982015 15:88819153-88819175 AGTACAGGCTGGCAGAGGACTGG + Intronic
1141698522 16:85631998-85632020 GGTTCAGGCTGGCCGAGGACGGG + Intronic
1151593084 17:75059571-75059593 TGTCCACGATGTCCGACGGCTGG + Exonic
1160593834 18:79961109-79961131 AGGCCATGCTGGCCAAGGACTGG - Intergenic
1162894421 19:13756634-13756656 AGTCCAGGCTGGCCTGCTACAGG - Intronic
925188094 2:1863294-1863316 AGTCCACGCTGGCCACCTGCAGG + Intronic
937924205 2:127155059-127155081 AGACCACCCTGGCCGACATCTGG - Intergenic
942461599 2:176172118-176172140 AGTCCACGCTGGCCGACGACGGG - Exonic
1176189278 20:63800298-63800320 AGTCCACAGTGGCAGACAACCGG + Intronic
1185340936 22:50290803-50290825 AGTCCACCCTGACTGACCACTGG + Intronic
954144668 3:48628663-48628685 AGTACACGGTGGCCGAGGAGCGG + Exonic
959392393 3:105792515-105792537 AGTACACGCTGTCCCAGGACTGG - Intronic
979513527 4:121581226-121581248 AGACCAGGCTGGCCGACGTGGGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
998043654 5:138969366-138969388 AGTCCTCTCTGGCTGAAGACTGG + Intronic
999369763 5:151047474-151047496 ACTCCATGCTGGCACACGACAGG + Intronic
1022186138 7:27971310-27971332 AGTCCACGCTGGCTGAGGATGGG + Intronic
1037992108 8:23328442-23328464 AGACCACACTGGCCGACACCAGG + Exonic
1045412295 8:101931076-101931098 GGTCCACGCTGGCGGACATCAGG - Intronic
1050287416 9:4118005-4118027 AGGCCACCCTGGACGACGACGGG - Exonic
1057194846 9:93111241-93111263 AGTCCACACTGCCTGAGGACAGG - Intronic