ID: 942467482

View in Genome Browser
Species Human (GRCh38)
Location 2:176223973-176223995
Sequence TTAAGGACCCTTGTGATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942467478_942467482 3 Left 942467478 2:176223947-176223969 CCACTGCGCCTGGCCTGCTTCTA No data
Right 942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG No data
942467479_942467482 -5 Left 942467479 2:176223955-176223977 CCTGGCCTGCTTCTACTTTTAAG No data
Right 942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG No data
942467476_942467482 30 Left 942467476 2:176223920-176223942 CCATAGTGCTGGGATTACAGGCA 0: 418
1: 93869
2: 234187
3: 242657
4: 215337
Right 942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG No data
942467481_942467482 -10 Left 942467481 2:176223960-176223982 CCTGCTTCTACTTTTAAGGACCC No data
Right 942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942467482 Original CRISPR TTAAGGACCCTTGTGATTCT TGG Intergenic
No off target data available for this crispr