ID: 942468811

View in Genome Browser
Species Human (GRCh38)
Location 2:176238430-176238452
Sequence AAGGGTAAATATAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942468811_942468820 14 Left 942468811 2:176238430-176238452 CCCCCCTCCTTATATTTACCCTT No data
Right 942468820 2:176238467-176238489 ACCAGCTAATTTGTCCTGTAGGG No data
942468811_942468819 13 Left 942468811 2:176238430-176238452 CCCCCCTCCTTATATTTACCCTT No data
Right 942468819 2:176238466-176238488 AACCAGCTAATTTGTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942468811 Original CRISPR AAGGGTAAATATAAGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr