ID: 942469252

View in Genome Browser
Species Human (GRCh38)
Location 2:176242670-176242692
Sequence CATTTCCCACAAACATCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942469245_942469252 5 Left 942469245 2:176242642-176242664 CCCAGAAAGTCCTGCACATGCCT 0: 1
1: 0
2: 1
3: 21
4: 187
Right 942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 89
942469248_942469252 -5 Left 942469248 2:176242652-176242674 CCTGCACATGCCTGGCACCATTT 0: 1
1: 0
2: 3
3: 20
4: 210
Right 942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 89
942469246_942469252 4 Left 942469246 2:176242643-176242665 CCAGAAAGTCCTGCACATGCCTG 0: 1
1: 0
2: 2
3: 10
4: 215
Right 942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942469252 Original CRISPR CATTTCCCACAAACATCCGT GGG Intergenic
904096175 1:27979279-27979301 CATTTCCCAGAAACAGTCCTGGG + Intronic
905225039 1:36473425-36473447 CATCACCCACCAACATCCATGGG + Exonic
907789649 1:57649510-57649532 AATTTCCCACAAATATCTCTGGG - Intronic
909187439 1:72506091-72506113 CATTACCAACACACATCTGTTGG - Intergenic
923222056 1:231904262-231904284 CATTTCCCTCAAAAATTCATTGG + Intronic
1065702246 10:28436757-28436779 CATTTCCCACGAACACCCGTGGG + Intergenic
1070215259 10:74372098-74372120 CATTTCCCATGAACACCCATGGG + Intronic
1071180976 10:82983142-82983164 CATTTCCCACAAATATCATCAGG - Intronic
1073152551 10:101321815-101321837 CATTCCCCACACACATCTGATGG - Intergenic
1073433720 10:103503284-103503306 CATTTCCCAAAGCCATCCGGGGG - Intronic
1074969814 10:118526842-118526864 CATATCCCACAAAGCTCCCTTGG - Intergenic
1077816882 11:5694269-5694291 CATTTCAAAGAAACATCTGTTGG - Intronic
1088117795 11:106332492-106332514 CAATTCCCCCCAACATCCTTCGG + Intergenic
1094719033 12:33043476-33043498 CACTTCCCACTAACATCTGCAGG - Intergenic
1096648514 12:53050613-53050635 CATTTCCCTCAAACTTCCCTGGG - Intronic
1101687202 12:107036795-107036817 CATTTCCCTCATACATCCACAGG + Intronic
1105056426 12:133104109-133104131 CATTTCAGTCAAACATACGTTGG - Intronic
1109413413 13:62004450-62004472 AATATCCCACAAATGTCCGTTGG + Intergenic
1114406266 14:22459110-22459132 CAGTTCCGAAAAACATCTGTCGG - Intergenic
1118834408 14:69466425-69466447 CATTTCCCATAAACATTTCTAGG - Intergenic
1119943148 14:78662765-78662787 CATGTCCCACAAACATTTATTGG + Intronic
1120228432 14:81817239-81817261 ATTTTCCCACAAACATCCTGAGG - Intergenic
1120976997 14:90257476-90257498 CATTTCCCTCAGACATCTGCAGG - Intronic
1121782123 14:96628670-96628692 CATCTCCCACAAACCCCCATTGG - Intergenic
1123794838 15:23761115-23761137 CAGTACCCACAAATATCTGTAGG - Intergenic
1126414309 15:48401933-48401955 CATTTCTAACAAACACCCATGGG - Intergenic
1127271778 15:57408203-57408225 CATTTCCCACAAGCAGCTGAAGG + Intronic
1127343712 15:58072171-58072193 GATGTGCCACAAACTTCCGTTGG - Intronic
1135618090 16:23929198-23929220 AATTTCCCACAAATGTCCTTCGG - Intronic
1140319956 16:73940939-73940961 CATTTCCCATGAACACCCCTGGG - Intergenic
1142257006 16:89018904-89018926 CCTTTCCCAGAAGCACCCGTAGG + Intergenic
1151438093 17:74110738-74110760 CACTTCCCACACACTTGCGTGGG - Intergenic
1153468516 18:5416295-5416317 CATCTCCCACAGAGCTCCGTAGG - Exonic
1153471249 18:5448264-5448286 CATGTCCCACCTCCATCCGTTGG - Intronic
1168443510 19:56392032-56392054 CATTTCCCCTAAACATCCAGTGG + Intronic
928700752 2:33896304-33896326 AATTTCCCACATAAATCTGTTGG - Intergenic
929625482 2:43402603-43402625 CTCTGCCCACACACATCCGTAGG + Intronic
934905628 2:98199324-98199346 CTTTTCACACAAAAATCTGTAGG - Intronic
936704103 2:115050478-115050500 CATTTTTGACAAACATCCTTGGG - Intronic
936737889 2:115468611-115468633 CATCTCCCATGAACATCCATGGG + Intronic
942068913 2:172297748-172297770 CATTTCACACAAATGTCCTTGGG + Intergenic
942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG + Intergenic
944211559 2:197211283-197211305 CATTTCCCCACAACATCCCTGGG - Intronic
945474149 2:210262103-210262125 CATTTTCCACAGGCATCCATTGG - Intergenic
948642899 2:239386521-239386543 CCTTACCCACCAACATCCGTGGG - Intronic
948752104 2:240138795-240138817 CATTTCCCACAATGATCCTAGGG - Intergenic
1170523620 20:17214264-17214286 CATTTCCAACAATCATCACTTGG - Intergenic
1171353484 20:24523858-24523880 CATTTATAACAAACACCCGTGGG - Intronic
1173951680 20:46998374-46998396 CATTGCCCACAACCACCAGTTGG + Intronic
1175441773 20:58997321-58997343 CATTCCGCACAACCATCCATAGG + Intronic
1175719870 20:61279510-61279532 CATTTCCCACAGTCACCCATGGG + Intronic
1177536644 21:22436807-22436829 CATTTCTCAACAACATCAGTAGG + Intergenic
957974747 3:87429383-87429405 CATTTTCCACAACAATCCATAGG + Intergenic
959816746 3:110682588-110682610 CATTTCCCATGAACACCCATGGG - Intergenic
966815714 3:183888125-183888147 CATTTCCCTCGAACACCCATGGG + Intergenic
969576859 4:8041185-8041207 CTTTGCCCACCAACATCCCTTGG + Intronic
972222505 4:36972264-36972286 CATACCTCACAAACATCCCTGGG + Intergenic
975981235 4:80161689-80161711 CATTTCCCATACACACCCATGGG + Intergenic
979381166 4:120008574-120008596 TCATTCTCACAAACATCCGTGGG + Intergenic
981323968 4:143425606-143425628 CATTTCCCGTGAACATCCATGGG + Intronic
984867846 4:184298023-184298045 CATTTCCCAGTTACATCCCTAGG - Intergenic
985165851 4:187093073-187093095 CATTTCCCCCAGACAGCCCTGGG - Intergenic
990974646 5:61548770-61548792 CACTTCCCTCAGGCATCCGTGGG - Intergenic
991597000 5:68316085-68316107 CACTACCCACAAACACCCCTGGG - Intergenic
993332477 5:86617818-86617840 CATTTCCCACAATCCTTCGGGGG + Intergenic
993859326 5:93115425-93115447 CATCTCCCACAATAATCCTTGGG - Intergenic
999920471 5:156313610-156313632 GATTTCCCACAGACATTCGGAGG - Intronic
1003781719 6:9435669-9435691 CATATCACAAAAAAATCCGTGGG + Intergenic
1005734462 6:28732580-28732602 CATTTCCCGTGAACACCCGTGGG + Intergenic
1013666626 6:112356144-112356166 CATTTCCTGCGAACACCCGTGGG - Intergenic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1022341685 7:29474486-29474508 CAGTTCACACAAACACCAGTGGG + Intronic
1026869810 7:73843439-73843461 CATTTCTCACAAGCTTCCCTAGG - Intergenic
1027488606 7:78793214-78793236 CATATCTCTCAAACATCAGTTGG - Intronic
1028820779 7:95209412-95209434 CGCTTCCCACAAACACCCGCAGG - Intronic
1032880895 7:136089337-136089359 CTTTTCCACCAAACATCCTTTGG + Intergenic
1041113344 8:54508436-54508458 CATTTTCCACAAACAACAGCAGG - Intergenic
1043470698 8:80559433-80559455 CATTTCCCGTGAACACCCGTGGG + Intergenic
1044977591 8:97680985-97681007 CATTTGTCACAAACTTCCTTGGG - Intronic
1046376668 8:113391431-113391453 CATTTCTAACAAAGTTCCGTGGG + Intronic
1050557389 9:6800936-6800958 CATTTTAAACAAACATACGTTGG + Intronic
1055756796 9:79566857-79566879 CCCTTCCCACACACATCCTTTGG - Intergenic
1059280699 9:113131154-113131176 CATTTGCCAAAATCATCCCTTGG + Intergenic
1061556725 9:131374871-131374893 TATTTCCCACACACATCCCAGGG + Intergenic
1061808188 9:133148097-133148119 CATTTTCCACAGACCTCGGTGGG + Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187531357 X:20099835-20099857 CATTTCCAACCAACACCCATAGG + Intronic
1192724647 X:73736009-73736031 CATTTCTCTCAAAAATCAGTTGG + Intergenic
1192754420 X:74031728-74031750 CATTTCCCGTGAACACCCGTGGG + Intergenic
1194799747 X:98257895-98257917 CTTTTTCCACAAAAATCAGTTGG - Intergenic
1194953814 X:100156185-100156207 CATTTCCCATGAACACCCATGGG - Intergenic
1195407627 X:104533805-104533827 CATTTCCCAAATGCATACGTTGG - Intergenic
1196927419 X:120647262-120647284 CATTTCCCTGAGACATCCCTGGG - Intergenic