ID: 942472968

View in Genome Browser
Species Human (GRCh38)
Location 2:176281697-176281719
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942472966_942472968 -3 Left 942472966 2:176281677-176281699 CCACAATAACCAAGGTGGTACTG No data
Right 942472968 2:176281697-176281719 CTGCCTGTTTTTCTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr