ID: 942475556

View in Genome Browser
Species Human (GRCh38)
Location 2:176316172-176316194
Sequence GTGGACCAAATAGCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942475552_942475556 26 Left 942475552 2:176316123-176316145 CCTCAAAGTTATGTCTTTCTGGC No data
Right 942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG No data
942475555_942475556 -8 Left 942475555 2:176316157-176316179 CCAGGAAGTTTCATAGTGGACCA No data
Right 942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942475556 Original CRISPR GTGGACCAAATAGCCTTTGT AGG Intronic
No off target data available for this crispr