ID: 942486449

View in Genome Browser
Species Human (GRCh38)
Location 2:176444896-176444918
Sequence CAGGAGAAAACAGCTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942486446_942486449 0 Left 942486446 2:176444873-176444895 CCTGAACTGATGGATGTCTCTAT No data
Right 942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG No data
942486444_942486449 22 Left 942486444 2:176444851-176444873 CCAAAGTAGTTTACATCGTTGTC No data
Right 942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942486449 Original CRISPR CAGGAGAAAACAGCTGTGGT AGG Intergenic
No off target data available for this crispr