ID: 942487434

View in Genome Browser
Species Human (GRCh38)
Location 2:176454186-176454208
Sequence AAACTCCTATAGAACTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942487434_942487438 15 Left 942487434 2:176454186-176454208 CCACCTAAGTTCTATAGGAGTTT No data
Right 942487438 2:176454224-176454246 TGGCTTTTAAAACATGGCTCAGG No data
942487434_942487436 -5 Left 942487434 2:176454186-176454208 CCACCTAAGTTCTATAGGAGTTT No data
Right 942487436 2:176454204-176454226 AGTTTGATTAATAAGTGAACTGG No data
942487434_942487437 9 Left 942487434 2:176454186-176454208 CCACCTAAGTTCTATAGGAGTTT No data
Right 942487437 2:176454218-176454240 GTGAACTGGCTTTTAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942487434 Original CRISPR AAACTCCTATAGAACTTAGG TGG (reversed) Intergenic
No off target data available for this crispr