ID: 942490027

View in Genome Browser
Species Human (GRCh38)
Location 2:176480742-176480764
Sequence CAAGAACAGTCTTTTCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942490027_942490033 27 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490033 2:176480792-176480814 TGGCTGTGCAGAGGAAGGTTGGG No data
942490027_942490030 18 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490030 2:176480783-176480805 ACTTTTTAATGGCTGTGCAGAGG No data
942490027_942490034 28 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490034 2:176480793-176480815 GGCTGTGCAGAGGAAGGTTGGGG No data
942490027_942490032 26 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG No data
942490027_942490029 7 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490029 2:176480772-176480794 GAGGAGAGTGAACTTTTTAATGG No data
942490027_942490035 29 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490035 2:176480794-176480816 GCTGTGCAGAGGAAGGTTGGGGG No data
942490027_942490031 22 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490031 2:176480787-176480809 TTTAATGGCTGTGCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942490027 Original CRISPR CAAGAACAGTCTTTTCAACT TGG (reversed) Intergenic
No off target data available for this crispr