ID: 942490032

View in Genome Browser
Species Human (GRCh38)
Location 2:176480791-176480813
Sequence ATGGCTGTGCAGAGGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942490027_942490032 26 Left 942490027 2:176480742-176480764 CCAAGTTGAAAAGACTGTTCTTG No data
Right 942490032 2:176480791-176480813 ATGGCTGTGCAGAGGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942490032 Original CRISPR ATGGCTGTGCAGAGGAAGGT TGG Intergenic
No off target data available for this crispr