ID: 942491153

View in Genome Browser
Species Human (GRCh38)
Location 2:176490698-176490720
Sequence CCACAGCAGCCGCCCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942491149_942491153 -3 Left 942491149 2:176490678-176490700 CCCCACAGCGGCGCTTCTGTCCA No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491143_942491153 17 Left 942491143 2:176490658-176490680 CCGGGACACGGCCTGCCCCTCCC No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491141_942491153 27 Left 942491141 2:176490648-176490670 CCGCCGATGGCCGGGACACGGCC No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491148_942491153 0 Left 942491148 2:176490675-176490697 CCTCCCCACAGCGGCGCTTCTGT No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491147_942491153 1 Left 942491147 2:176490674-176490696 CCCTCCCCACAGCGGCGCTTCTG No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491146_942491153 2 Left 942491146 2:176490673-176490695 CCCCTCCCCACAGCGGCGCTTCT No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491142_942491153 24 Left 942491142 2:176490651-176490673 CCGATGGCCGGGACACGGCCTGC No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491145_942491153 6 Left 942491145 2:176490669-176490691 CCTGCCCCTCCCCACAGCGGCGC No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491150_942491153 -4 Left 942491150 2:176490679-176490701 CCCACAGCGGCGCTTCTGTCCAC No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data
942491151_942491153 -5 Left 942491151 2:176490680-176490702 CCACAGCGGCGCTTCTGTCCACA No data
Right 942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942491153 Original CRISPR CCACAGCAGCCGCCCAGCGC AGG Intergenic
No off target data available for this crispr