ID: 942496027

View in Genome Browser
Species Human (GRCh38)
Location 2:176541046-176541068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942496020_942496027 8 Left 942496020 2:176541015-176541037 CCACTATGGAAGGTACTGAGAAT No data
Right 942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG 0: 36
1: 155
2: 521
3: 2021
4: 6837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr