ID: 942497147

View in Genome Browser
Species Human (GRCh38)
Location 2:176551830-176551852
Sequence TCACCCTTACCAATATGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942497146_942497147 22 Left 942497146 2:176551785-176551807 CCAGAAGAGATTAGCATTTGAAT 0: 76
1: 225
2: 371
3: 918
4: 2619
Right 942497147 2:176551830-176551852 TCACCCTTACCAATATGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942497147 Original CRISPR TCACCCTTACCAATATGCGC TGG Intergenic
No off target data available for this crispr