ID: 942506062

View in Genome Browser
Species Human (GRCh38)
Location 2:176642803-176642825
Sequence TGGCTGTTATTGCTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942506056_942506062 15 Left 942506056 2:176642765-176642787 CCAAAACAGTTAGAATTAATCTT No data
Right 942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942506062 Original CRISPR TGGCTGTTATTGCTGGGACA GGG Intergenic
No off target data available for this crispr