ID: 942511306

View in Genome Browser
Species Human (GRCh38)
Location 2:176705066-176705088
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942511302_942511306 15 Left 942511302 2:176705028-176705050 CCAAAATGTCTAAACAATAAAGA No data
Right 942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr