ID: 942516527

View in Genome Browser
Species Human (GRCh38)
Location 2:176759366-176759388
Sequence GTACAAAATCACAATTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942516527_942516529 24 Left 942516527 2:176759366-176759388 CCTGTATAATTGTGATTTTGTAC 0: 1
1: 0
2: 5
3: 46
4: 408
Right 942516529 2:176759413-176759435 CAAATTCTTCAACCATTTCATGG 0: 1
1: 0
2: 1
3: 32
4: 264
942516527_942516530 25 Left 942516527 2:176759366-176759388 CCTGTATAATTGTGATTTTGTAC 0: 1
1: 0
2: 5
3: 46
4: 408
Right 942516530 2:176759414-176759436 AAATTCTTCAACCATTTCATGGG 0: 1
1: 0
2: 1
3: 23
4: 322
942516527_942516531 26 Left 942516527 2:176759366-176759388 CCTGTATAATTGTGATTTTGTAC 0: 1
1: 0
2: 5
3: 46
4: 408
Right 942516531 2:176759415-176759437 AATTCTTCAACCATTTCATGGGG 0: 1
1: 0
2: 0
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942516527 Original CRISPR GTACAAAATCACAATTATAC AGG (reversed) Intergenic
903230073 1:21916342-21916364 ATACAAAAACACAATTAGTCAGG + Intronic
905054426 1:35080610-35080632 GTACAAAACCACAAATAGCCGGG - Intronic
905575666 1:39042576-39042598 ATACAAAATTTCAATTAGACTGG - Intergenic
908279696 1:62519189-62519211 TTACAAAACCACAATTGTAGTGG + Intronic
908684550 1:66700781-66700803 GTACAAAATTACAACTAGATAGG - Intronic
908857328 1:68445480-68445502 GTACAAAATCAGATTTTAACTGG - Intronic
908907425 1:69032140-69032162 GTACAAAATAACACAGATACAGG + Intergenic
909064404 1:70917133-70917155 GTACAAAGTTACAATTAGACAGG - Intronic
909193809 1:72590217-72590239 GTACAAAATTAGATTTATAAAGG - Intergenic
909346637 1:74596580-74596602 GTACAAAGTTACAGTTAGACAGG - Intronic
909493965 1:76257417-76257439 GTACTAAATCAGAATCTTACAGG - Intronic
909516441 1:76512670-76512692 GTACAAAGTTACAATTAGACAGG - Intronic
909532978 1:76701566-76701588 GTACAAAATGACAATCAAATTGG + Intergenic
909550102 1:76889019-76889041 ATACAAAATTTCAATTAGACAGG - Intronic
910151566 1:84153511-84153533 GTACAAAATTTCACTTAGACAGG - Intronic
910379919 1:86614990-86615012 ATACAAAAACACAATTAGCCAGG - Intergenic
910873266 1:91854111-91854133 ATACAAAATTTCAATTAGACAGG + Intronic
910885023 1:91955020-91955042 GTACAGAGTTACCATTATACTGG - Intronic
911193880 1:94974436-94974458 GAAAAAAATCTCAGTTATACAGG + Exonic
911245763 1:95515375-95515397 GTACATAATCACACTTAGATAGG - Intergenic
911828265 1:102515695-102515717 GTACAAAGTTACAATTAAAAAGG + Intergenic
912016649 1:105046323-105046345 ATACAAAATTACAGTTAGACAGG - Intergenic
912239269 1:107887945-107887967 TTACAAAATAACAATTTTTCTGG + Intronic
912583485 1:110740236-110740258 GCACAAAGTCACAATTAGATGGG + Intergenic
912591654 1:110827083-110827105 GTACAAAATTTCAAGTAGACAGG + Intergenic
912831977 1:112961031-112961053 GTACAAAGTGACAATTAGATTGG - Intergenic
914205628 1:145525163-145525185 TCACAAAATTACAATTAGACAGG - Intergenic
914436316 1:147663335-147663357 GTACAAAATTTCAGTTACACAGG + Intronic
914736276 1:150420107-150420129 GTTCTTATTCACAATTATACTGG - Intronic
915048233 1:153038541-153038563 GTACAAAGTTACAGTTAAACGGG - Intergenic
916621690 1:166504754-166504776 GTACAAAGTTACAATTAGAAAGG + Intergenic
917239921 1:172937056-172937078 ATACAAAATTTCAATTAGACTGG + Intergenic
918503289 1:185222883-185222905 GTACAAAGTTACAATTAGATAGG - Intronic
918578736 1:186099043-186099065 GTACAAAGTTACAATTAGAAAGG + Intronic
919011077 1:191963964-191963986 CTACTAATTCACAATTATAAGGG + Intergenic
921617752 1:217291351-217291373 GTACAAAATTACAGTTAGATAGG - Intergenic
921624831 1:217368131-217368153 TTACAAAAACTCAAATATACAGG - Intergenic
922655938 1:227383425-227383447 ATACAAAACCAAAATTAGACAGG - Intergenic
922850020 1:228724724-228724746 GTACAAAATTTCAATTAGGCAGG - Intergenic
922990020 1:229899056-229899078 AGACAAATTCACAATTATAATGG + Intergenic
923850652 1:237790556-237790578 GAATAAAATAATAATTATACTGG + Intronic
923932637 1:238720251-238720273 GTACATAATTACAATTAGATAGG + Intergenic
924134228 1:240946758-240946780 GTACAAAATTACACTTAGGCAGG + Intronic
924355356 1:243168673-243168695 GTACAAAATCTCACTTAGACAGG - Intronic
1063602329 10:7493639-7493661 GTACCACATCACAAATATAAAGG + Intergenic
1063910379 10:10823128-10823150 TTAAAAAATCACAATTAGAAAGG + Intergenic
1064009815 10:11726785-11726807 GTACAAAGTCCCAGTTATGCAGG + Intergenic
1064814134 10:19237238-19237260 TTATGAAATCACAATTATATAGG - Intronic
1065078750 10:22107199-22107221 GTACAAAATTTCAGTTAGACAGG - Intergenic
1065385924 10:25133060-25133082 GTACAAAATCTCAGCTAGACAGG + Intergenic
1065705323 10:28466905-28466927 GTACAAAGTTACAATTAGATAGG + Intergenic
1065957139 10:30703896-30703918 GTACAAAATGACAATCAGAGAGG - Intergenic
1066091548 10:32026275-32026297 ATACAAAAACAAAATTATCCAGG + Intronic
1066115518 10:32235831-32235853 ATACATGATAACAATTATACAGG - Intergenic
1066603003 10:37127314-37127336 GTACAAAATGATAAAAATACCGG + Intronic
1068439733 10:57036422-57036444 GTACCAAGTCACAATTAGAAAGG - Intergenic
1069229280 10:65988071-65988093 GTACAAAAATACAGTTATATAGG + Intronic
1069244608 10:66188330-66188352 GTACAAAATTGCAATGATGCAGG - Intronic
1070049371 10:72872351-72872373 GTACAAAATTACAGTTAGATAGG - Intronic
1071078900 10:81785706-81785728 GTACCAAATCTCAATTAGACAGG - Intergenic
1071115680 10:82216790-82216812 TTCCAAAAACACAATAATACTGG - Intronic
1071710491 10:88044423-88044445 GTACAAAACCAAAAGTCTACAGG - Intergenic
1073727833 10:106254917-106254939 ATACATAATCACAATTAGACAGG + Intergenic
1073761490 10:106633420-106633442 GTCCAAAATCACAGTTAGACAGG - Intronic
1073813123 10:107173259-107173281 GTACAAAGTTACAGTTATATAGG + Intergenic
1078519939 11:12054809-12054831 GTACAAAGTTTCAATTATACAGG - Intergenic
1078523181 11:12080067-12080089 GTACAAAATCACTTTCATTCAGG - Intergenic
1078648941 11:13169126-13169148 GTACAAAATGTCAGTTATGCAGG + Intergenic
1078734104 11:14003884-14003906 ATACAAAATAACAGTTATATAGG - Intronic
1079871177 11:25800102-25800124 GAAAAAAATCATAATTATAAAGG + Intergenic
1081017589 11:37902299-37902321 ATACAAAATTACAATTGGACAGG + Intergenic
1081106942 11:39082188-39082210 GTATAAAAACATAATTATATTGG + Intergenic
1081134785 11:39426751-39426773 ATACAAAACTACAATTAGACAGG + Intergenic
1081253596 11:40865335-40865357 GTACAAAATTACAGTTAGATAGG + Intronic
1081393932 11:42562669-42562691 GTACAAGAGCACAGTTATATGGG + Intergenic
1081615787 11:44590448-44590470 ATACAAAAACAAAATTATTCAGG + Intronic
1081833894 11:46137556-46137578 GTACAGAATCTCAAATACACAGG + Intergenic
1082687261 11:56256089-56256111 ATATAAAATAACAATTAAACAGG + Intergenic
1082795382 11:57375291-57375313 ATACAAATTCACACATATACAGG + Intergenic
1085883247 11:80492611-80492633 ATACAAAATTTCAATTAAACAGG - Intergenic
1085891282 11:80582445-80582467 GTACAACATCAGAAATATAAAGG - Intergenic
1085986744 11:81796981-81797003 TAACAAATTCACAATTATACTGG - Intergenic
1087480110 11:98689454-98689476 GTTTAAAATCATAATAATACTGG + Intergenic
1087515099 11:99149493-99149515 GTATAAAATCATAATTATGAAGG + Intronic
1087584585 11:100102305-100102327 GTTCAACATCACAATTATCAGGG - Intronic
1087955372 11:104279810-104279832 GTACAAAGTTACAATCAAACAGG - Intergenic
1088432250 11:109771560-109771582 GTACAAAGTTACAGTTAGACAGG - Intergenic
1092452519 12:8616242-8616264 GTACAAAGTTGCAGTTATACAGG - Intergenic
1092819221 12:12337398-12337420 GTACAAAAACAAAATTAGCCGGG + Intronic
1093393924 12:18656762-18656784 CAACAAAAACACAATTATACAGG + Intergenic
1093801923 12:23383812-23383834 GTACAAAATTTCAGTTAGACTGG + Intergenic
1095156028 12:38855609-38855631 GTACAAAATTTCAGTTAGACAGG + Intronic
1095499510 12:42821265-42821287 GTACAAAATTACAGTTAGATAGG - Intergenic
1097780340 12:63696140-63696162 GTATAAAATGAAAAATATACTGG - Intergenic
1097805812 12:63963642-63963664 GTAAAAAATTACAATTAGATTGG - Intronic
1098204382 12:68092656-68092678 GTCCAAAATCATAATTACAAAGG + Intergenic
1098299454 12:69039131-69039153 GTTCAAAATCACAGTTATGTTGG - Intergenic
1098418754 12:70268098-70268120 GGACAAAATGAAAATAATACCGG - Intronic
1099427340 12:82539775-82539797 GTACAAAATTTCAGTTACACAGG - Intergenic
1099429495 12:82565117-82565139 ATACAAAATGAATATTATACGGG + Intergenic
1100091392 12:90976202-90976224 GTATAAAATTTCAGTTATACAGG + Intronic
1100100540 12:91098670-91098692 GTACAAAGTTTCAATTAGACAGG + Intergenic
1101042058 12:100765981-100766003 GTACAAAATTTCAATTAGATAGG - Intronic
1102733283 12:115133936-115133958 GTACAAAATCACAGCTAGATAGG + Intergenic
1103696835 12:122822463-122822485 GTACAAAGTTTCAATTAGACAGG - Intronic
1104187482 12:126446626-126446648 GTACAAAATCTCACTTATGCAGG + Intergenic
1104848637 12:131860234-131860256 GTACAAAAACAAAATTATCTGGG + Intergenic
1105906298 13:24813318-24813340 CTACAAAATAATAATTAGACAGG - Intronic
1106448167 13:29855152-29855174 GTACAAAATTCCAGTTAGACAGG + Intergenic
1106905279 13:34401659-34401681 GTACATACTCAAAATTATAGTGG + Intergenic
1107106966 13:36654319-36654341 GTACAAAGTTACAATTAGAAAGG - Intergenic
1107112538 13:36713404-36713426 GTACAAAGTTACAGTTAAACAGG - Intergenic
1107399422 13:40054933-40054955 CTACAATATCATAAGTATACTGG + Intergenic
1107543859 13:41418315-41418337 GTACAAAGTTACAGTTAGACAGG + Intergenic
1108027426 13:46192707-46192729 GTACAAAATTTCAGTTAGACAGG + Intronic
1109479884 13:62937199-62937221 GTACAAAGTTACAATTAGACAGG + Intergenic
1109754848 13:66743530-66743552 ATACAAAATTTCAATTAGACAGG + Intronic
1109893614 13:68653160-68653182 GAACAAAAGCACTATGATACTGG - Intergenic
1109991392 13:70062047-70062069 ATACAAAATTACAACTAGACAGG - Intronic
1110068237 13:71137451-71137473 CTATAAAATCATAAATATACTGG - Intergenic
1110999043 13:82154185-82154207 GTACACAATCTCAATTAAGCAGG + Intergenic
1111078500 13:83270513-83270535 GTACAAAGTTACAGTTAGACAGG + Intergenic
1111205700 13:85007607-85007629 TTACAAAATTACACTTAGACAGG - Intergenic
1111314209 13:86531209-86531231 GTACAAAATCTTAATTAGGCAGG + Intergenic
1111602365 13:90491157-90491179 GTACAAAGTTACAATTAAATAGG - Intergenic
1111878318 13:93923409-93923431 TTACAAAATCCCAATCTTACAGG + Intronic
1115691467 14:35848565-35848587 GTACAAAATTTCAGTTAGACAGG - Intronic
1115952996 14:38742517-38742539 GTACAAAGTTACAGTTAGACAGG + Intergenic
1116024640 14:39500255-39500277 GTACAAAGTTACAATTAGATAGG - Intergenic
1116558151 14:46339669-46339691 ATACAACATCACAATCATTCTGG + Intergenic
1117733648 14:58748552-58748574 GTACAAAAACAAAATTAGCCAGG - Intergenic
1117999273 14:61507804-61507826 GTACAAAATTTCAGTTATGCAGG + Intronic
1118499069 14:66340243-66340265 GTTCAAATTCACAATTACAAAGG + Intergenic
1119340599 14:73874249-73874271 GCACAAAGTAAGAATTATACGGG - Intronic
1119371070 14:74143877-74143899 GCACAAAATTACAATTATACAGG - Intronic
1119833900 14:77729558-77729580 GTACAAAGTCTCATTTATGCAGG + Intronic
1120308931 14:82805734-82805756 GTACAAAGTTACAGTTAGACAGG - Intergenic
1120312632 14:82850280-82850302 GTACAAAGTTACAATTAGAAAGG + Intergenic
1120354390 14:83412048-83412070 TTACCAAAACACAAATATACTGG + Intergenic
1121184493 14:91954581-91954603 GTACATAATCAGAATTACAGAGG - Intergenic
1121581053 14:95030982-95031004 ATACAAAATCACAGATAGACAGG + Intergenic
1121920979 14:97881273-97881295 GTACAAAATTACAAATAGATAGG + Intergenic
1122671398 14:103375399-103375421 GTCCAAAATGTCAATTTTACTGG + Intergenic
1124703503 15:31938544-31938566 GTACAAAATTACAATAAAAATGG + Intergenic
1125446339 15:39761599-39761621 GTACAAAGTCTCAGTTAGACAGG + Intronic
1126636449 15:50784893-50784915 GTAAGAAATCACAATAAAACTGG + Intergenic
1127000710 15:54501075-54501097 GTACAGAATTACAAATAAACTGG - Intronic
1128984943 15:72212912-72212934 GTACAAAAACAAAATTAGCCGGG + Intronic
1129357469 15:75001111-75001133 GTACAAAAACAAAATTAGCCGGG + Intronic
1131163306 15:90124011-90124033 GTACAAATCCTCAATTAGACAGG - Intergenic
1131349412 15:91683876-91683898 GTACAAAATTTCAGTTAGACAGG - Intergenic
1133828011 16:9296143-9296165 GTACAAAAGCGCAAATATATCGG + Intergenic
1134030996 16:10992221-10992243 GTACAAAGTTCCAATTAGACAGG - Intronic
1135273609 16:21090782-21090804 GTACAAAGTTTCAGTTATACTGG + Intronic
1136658749 16:31734636-31734658 GTATAAAGTTACAATTACACAGG - Intronic
1137396721 16:48121060-48121082 GTACAAAGTTTCAATTAGACAGG - Intronic
1137894964 16:52201714-52201736 GTACAAAAATACAGTTAAACAGG + Intergenic
1138048071 16:53746811-53746833 GTACAAAGCCTCAATTAGACAGG - Intronic
1138637292 16:58351093-58351115 GTACAAAATCACAGTTAGACAGG + Intronic
1139553775 16:67692867-67692889 ATACAAAAACAAAATTATCCAGG + Intronic
1139769555 16:69263015-69263037 GTACAAAGTTTCAATTAAACAGG - Intronic
1140145921 16:72308723-72308745 GTAGACAATCACAAATATAATGG + Intergenic
1140766249 16:78160886-78160908 AGACAAATTCACAATTATAATGG - Intronic
1141710063 16:85693456-85693478 GTACAAAGTCTCAGTTAGACAGG - Intronic
1203144064 16_KI270728v1_random:1788053-1788075 GTACAAAGTTACAATTAAATAGG + Intergenic
1143064423 17:4233981-4234003 GTACAATATTATAATTTTACGGG - Intronic
1143282963 17:5768397-5768419 GTACAATATCACAAATGTGCTGG - Intergenic
1144354669 17:14434006-14434028 GTACAAAGTCTCGATTATGCAGG - Intergenic
1145076507 17:19859356-19859378 ATACAAAAACAAAATTATCCAGG + Intronic
1145358675 17:22190123-22190145 GTACAAAGTTACAGTTAGACAGG - Intergenic
1147217144 17:38907436-38907458 GGACAAAATCACAGCTAGACAGG - Intronic
1150010572 17:61498819-61498841 GTACAAAAGGACAATTAACCAGG + Intergenic
1150428026 17:65092857-65092879 GTACAAAAACAAAATTAGCCGGG - Intergenic
1150985251 17:70188920-70188942 GTACAAAGTTACAATTAGATAGG - Intergenic
1153393079 18:4585226-4585248 GTACAAATTCACAAAAATTCTGG + Intergenic
1153702105 18:7705553-7705575 CTACATAATAACAATTACACTGG - Intronic
1153928633 18:9858552-9858574 ACACAAAATCAAAATTAAACAGG - Intronic
1154231247 18:12558010-12558032 GTACAAAAATAAAATCATACTGG + Intronic
1155431290 18:25762008-25762030 ATACAAAATTTCAATTATACAGG - Intergenic
1156053408 18:32968094-32968116 GTACAACGTTACAATTAGACAGG - Intronic
1156343312 18:36232592-36232614 GTACAAAATTACAGGTATATAGG - Intronic
1156794098 18:41019963-41019985 ATATAAAATCACAATTAAATAGG + Intergenic
1157393594 18:47323631-47323653 GTACAAAATTTCAGTTAGACAGG + Intergenic
1158014178 18:52764872-52764894 GTCCAAAATAACAATTTTTCAGG + Intronic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1159334700 18:67047282-67047304 GTACAAAGTCACAGTTAGATAGG - Intergenic
1159786018 18:72715099-72715121 ATACAAAAACACAAAAATACAGG - Intergenic
1160264291 18:77326122-77326144 GTACAAAGTGACAATTATGTAGG - Intergenic
1162115354 19:8426068-8426090 ATACAAAAACACAATTAGCCGGG + Intronic
1168430105 19:56271989-56272011 GTACAAATTTACTATCATACAGG + Intronic
1168628801 19:57940451-57940473 CTACAAAATTACAACTAGACAGG + Intergenic
1168663863 19:58187580-58187602 CTACAAAAAAACAATTAAACGGG - Intronic
925859629 2:8162013-8162035 TTAAAAAATCAAAATTGTACTGG - Intergenic
926826372 2:16909338-16909360 ATACAAAAACAAAATTAGACTGG + Intergenic
926912970 2:17868570-17868592 GTTCAAAATCCCCATTTTACAGG + Intergenic
929315867 2:40477870-40477892 GTACCAAGTCACAACTATTCTGG - Intronic
929364389 2:41135062-41135084 GTATAAAATTTCAGTTATACAGG + Intergenic
929883362 2:45856654-45856676 GTACAAAGTTACAGTTAGACAGG - Intronic
930903615 2:56538600-56538622 GAATAAACTCACATTTATACAGG - Intergenic
931909529 2:66883214-66883236 GCACAAAATTTCAATTAGACAGG - Intergenic
931910466 2:66894206-66894228 GTACAAAGTTACAGTTATATAGG - Intergenic
931933089 2:67162954-67162976 GTACAACATCAAAATTCTAAAGG - Intergenic
932629961 2:73332345-73332367 CTACAGAATCAATATTATACAGG + Intergenic
932941885 2:76176747-76176769 GTACAAAGTCACAATTAGAGAGG - Intergenic
933087485 2:78074582-78074604 TTACAAAATCACAGTTTAACTGG + Intergenic
933259949 2:80121478-80121500 ATAAAAAATAACAATTATATTGG + Intronic
933421357 2:82049435-82049457 GTACATAATTATAATTAGACAGG + Intergenic
935220997 2:101012705-101012727 CTACAAAATAACAATTATCGGGG + Intronic
935520839 2:104103399-104103421 GTACAGAATCCCAATTAGACAGG + Intergenic
937567716 2:123315125-123315147 GTACAAAATTACAGTTAGACAGG + Intergenic
937721808 2:125107118-125107140 GTACAAAATTCCAATTATACAGG - Intergenic
937796344 2:126026661-126026683 TTACAAAATCAGAATTAAAAGGG - Intergenic
938529815 2:132173452-132173474 GTACAAAACCAAAATTAGCCGGG - Intronic
939033923 2:137108898-137108920 GAACAAAATCACAAATATTAAGG - Intronic
939093904 2:137810661-137810683 GTAGGAAATTACAATTATGCAGG - Intergenic
939436764 2:142186916-142186938 GTACAAAGTCACAATAAGATAGG - Intergenic
939490638 2:142872208-142872230 ATACAAAAACAAAATTAGACAGG + Intergenic
939720173 2:145639594-145639616 GTGCCAAATCTCAATTAGACGGG + Intergenic
939778231 2:146412408-146412430 TTACAAAATCATATTAATACAGG - Intergenic
940620319 2:156104385-156104407 GTACAAAATTACAGTTAGACAGG + Intergenic
940706820 2:157115874-157115896 GTACAAAATTTCAGTTATGCAGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
941067586 2:160920710-160920732 GTACAAAATCACCATGATTTGGG - Intergenic
941338674 2:164277934-164277956 GTACAAAGTAACAATTAGATTGG - Intergenic
941893882 2:170610177-170610199 ATACAAAAACAAAATTAGACGGG + Intronic
942309184 2:174638506-174638528 GTACAAAGTTACAATTAGACAGG - Intronic
942335106 2:174875255-174875277 CTACAAAACAATAATTATACAGG - Intronic
942516527 2:176759366-176759388 GTACAAAATCACAATTATACAGG - Intergenic
942527249 2:176867533-176867555 GTACAAAATTTCAGTTAAACAGG - Intergenic
943561294 2:189466154-189466176 GTACAAAATGAGGATAATACAGG - Intronic
944590362 2:201211340-201211362 GTACAAAGTTACAATTAGATAGG - Intronic
944603954 2:201332669-201332691 GTACAAAATCTCAATTAGGCAGG - Intronic
945410623 2:209502204-209502226 ATATAAGGTCACAATTATACAGG - Intronic
945768708 2:214013441-214013463 GTACAAAGTTACAATTAGATAGG - Intronic
946047329 2:216832276-216832298 GTACAAAAACAGAATTCTATGGG + Intergenic
946623438 2:221584776-221584798 GTACAAAATCTCAGTTAGACAGG - Intergenic
946945427 2:224816683-224816705 GAAGAAAATCAAATTTATACTGG + Exonic
948338456 2:237230117-237230139 ATCCAAGATCTCAATTATACTGG - Intergenic
948958117 2:241310301-241310323 GTACAAAACATCAATTAGACAGG + Intronic
1169250078 20:4053585-4053607 GTACAAAGTGACAATTAGATTGG + Intergenic
1169402045 20:5290267-5290289 GCACAAAATTTCAATTAGACAGG + Intergenic
1170542438 20:17402794-17402816 GTACAAAAACAAAATTAGCCAGG + Intronic
1171008895 20:21495951-21495973 GTACAAAACCACATTTACAAAGG + Intergenic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1173033618 20:39387202-39387224 GTACAAAGTTACAATTTTGCAGG + Intergenic
1173711383 20:45158722-45158744 CTACAAAATCACAGTTTGACAGG + Intergenic
1174689094 20:52485183-52485205 GTACAAAATTGCATTTATATAGG + Intergenic
1174750394 20:53106192-53106214 GTACAAAATTACAGTTAGATAGG - Intronic
1174971347 20:55279339-55279361 GTACAGACTCATAATTATATTGG - Intergenic
1178010459 21:28279668-28279690 GTACAAAATTACAGTTAGATAGG + Intergenic
1178208474 21:30499054-30499076 CTATAAAATCACAAATAAACAGG + Intergenic
1179263507 21:39779931-39779953 GTACAAAGTTTCAATTAGACAGG + Intronic
1182166238 22:28176455-28176477 GTACAAAGTTACAATTAGATGGG + Intronic
1182707304 22:32292881-32292903 AGACAAAATCACAATTATACTGG - Intergenic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
1184395646 22:44236266-44236288 AGACAAAATCACAATTATACTGG - Intergenic
949334973 3:2964750-2964772 CTACAAAGACACAATTATTCAGG + Intronic
951314579 3:21173297-21173319 GTACAAAATTACAGTTAGATAGG - Intergenic
951770741 3:26254505-26254527 GTACAAACTCACAGTTATGTAGG - Intergenic
953592417 3:44271859-44271881 GTACAAAACCTCAATTAAACAGG - Intronic
954569891 3:51631932-51631954 GTACAAAAATACAGTTAGACAGG - Intronic
955707779 3:61746364-61746386 ATACAAAAACAAAATTAGACGGG - Intronic
955844830 3:63151504-63151526 GTACAAAATTTCAGTTAGACAGG - Intergenic
956273593 3:67474097-67474119 ATACAAAAACAAAATTATCCGGG + Intronic
956397128 3:68838227-68838249 GTACAAAATTTCAGTTAGACAGG - Intronic
956911741 3:73825440-73825462 GTACAAAATCACTTTCATACTGG - Intergenic
957354507 3:79063978-79064000 GTAAAAAGTCACAGTTATACAGG + Intronic
957574785 3:81993194-81993216 GTACAAAGTTTCAGTTATACAGG + Intergenic
957665887 3:83226096-83226118 CTAATAAATCACATTTATACTGG + Intergenic
957683071 3:83463872-83463894 CTACAAAATGACAATTTTATAGG - Intergenic
957748655 3:84379804-84379826 ATAAAAAATCACAATTAAAATGG + Intergenic
957968387 3:87351409-87351431 GTACAAAATCAAGATTAATCAGG - Intergenic
958186434 3:90126204-90126226 GTACAAAGTTACAATTAGATAGG - Intergenic
958493439 3:94809301-94809323 GTACAAAGTTACAGTTATACAGG + Intergenic
959365028 3:105446895-105446917 GTACAAAGTCACAGTTAGATAGG + Intronic
959407833 3:105982446-105982468 GCACAAAATTACAATTAGAAAGG - Intergenic
959457828 3:106585757-106585779 GTACAAAATTATAGTTAGACAGG - Intergenic
959487080 3:106939191-106939213 GTACAAAAATACAATTAGATAGG - Intergenic
960210964 3:114965399-114965421 GTACAAAATTTCACTTAGACAGG - Intronic
960312046 3:116128999-116129021 ATATAAAATCACAAATAGACTGG + Intronic
960474057 3:118102330-118102352 GTACAAAGTCTCAGTTACACAGG - Intergenic
960646848 3:119895044-119895066 GTACAAAATTATAGTTAGACAGG - Intronic
960754525 3:120996569-120996591 GTACAAAGTTTCAGTTATACAGG - Intronic
962226107 3:133610981-133611003 GTATTAAAACACAATTATATAGG - Intronic
962628099 3:137247617-137247639 GTACAAAGTTACAATTACATAGG - Intergenic
962830913 3:139139455-139139477 ATACAAAATCTCAATTAGATAGG - Intronic
962976134 3:140447523-140447545 GAACAAAATCACGATTAAAATGG - Intronic
963464055 3:145655262-145655284 GTACAAAGTTACAGTTAGACAGG - Intergenic
965006909 3:163039335-163039357 GTACCAAATAACATTTATACAGG + Intergenic
965421182 3:168460590-168460612 ATACAAAATTTCAATTATATAGG + Intergenic
965503779 3:169488090-169488112 GGACAAATTCACAATTATAATGG + Intronic
965771853 3:172189886-172189908 ATAAAAGATCACAATTAAACTGG - Intronic
966100371 3:176261941-176261963 GTACAAAATTACAGTTACATAGG - Intergenic
966350229 3:179026080-179026102 GTTCAAAGAAACAATTATACTGG - Intronic
966664497 3:182455704-182455726 GTACAAAATTACAGTTAGATGGG - Intergenic
967448350 3:189594611-189594633 GTACAAAATTTCAGTTATGCAGG + Intergenic
968259900 3:197312463-197312485 ATACAAACTCACAGTTAGACAGG - Intergenic
970217288 4:13773141-13773163 GTACAAAAACAAAATTAGCCAGG - Intergenic
970413006 4:15828436-15828458 GTACAAAATCTCAGTTAGAAAGG - Intronic
970685978 4:18567725-18567747 GTGTAAAATAAAAATTATACTGG + Intergenic
970850435 4:20596204-20596226 GTACAAAATGTCATTTAGACAGG + Intronic
971084367 4:23254238-23254260 ATACAAAATTTCAATTATGCAGG - Intergenic
971661096 4:29417127-29417149 GTACAAAATGAAAATACTACTGG - Intergenic
972496657 4:39640612-39640634 GTACAAAACTAGAATTGTACTGG + Intergenic
972907051 4:43763276-43763298 GTGCCAAATCCTAATTATACAGG - Intergenic
972938644 4:44169807-44169829 GTACACAATGACTATGATACAGG - Intergenic
972982244 4:44719941-44719963 GTACAAAATAACCATAACACAGG + Intronic
973078354 4:45959514-45959536 GTACAAAGTTACAATTAGATAGG - Intergenic
974139957 4:57873276-57873298 GTACAAAATTTCAGTTAGACAGG + Intergenic
975175064 4:71279187-71279209 GTACAAAATTTCAATTAGACAGG - Intronic
975583500 4:75928098-75928120 GTACAAAGTTTCAATTAGACAGG - Intronic
976482363 4:85559504-85559526 ATACAAAATGCCAATTAGACAGG - Intronic
976713992 4:88103678-88103700 GTACAAAACCTCAGTTACACAGG - Intronic
976932592 4:90587065-90587087 GGACTCAATCACCATTATACTGG + Intronic
977982901 4:103346657-103346679 GTACAAAGTCACAACTAAACAGG - Intergenic
979647251 4:123085221-123085243 GAACTAAATCACAATTCAACTGG - Intronic
979922124 4:126511433-126511455 GCACAAAATTACAACTATATAGG - Intergenic
980230064 4:130037473-130037495 GTACAAAGTTACAATTACAAAGG + Intergenic
980520463 4:133926322-133926344 GAACAAAACCACAATGATGCAGG - Intergenic
981221063 4:142235580-142235602 ATACAAAAACAAAATTATCCAGG - Intronic
981622452 4:146717854-146717876 GTACAAAGCCTCAATTAGACAGG - Intronic
981670685 4:147283226-147283248 GTACAAAGTTTCAATTATGCTGG + Intergenic
982603362 4:157481513-157481535 GTACAAAATTACACATATATAGG + Intergenic
982688156 4:158517296-158517318 GTACAAAGTTACATTTAGACAGG + Intronic
982832746 4:160084897-160084919 GTAGAACATTTCAATTATACAGG - Intergenic
983023151 4:162704460-162704482 GTACAAAATTTCAATTATATAGG + Intergenic
983902129 4:173146810-173146832 TTACAGCATCACCATTATACTGG + Intergenic
983954505 4:173681581-173681603 GTACAAAATTGCATTTAGACAGG - Intergenic
984443948 4:179809639-179809661 GTACAAAGTTACAATTAAATAGG + Intergenic
986367728 5:7050712-7050734 GTACAAAATTTCAGTTAGACCGG + Intergenic
986904849 5:12484317-12484339 GTATAAAGTTACCATTATACAGG + Intergenic
987760257 5:22152724-22152746 ATACAAAATTTCAATTATATAGG - Intronic
987932037 5:24414480-24414502 GTACAAAGTTACAATTAGACAGG - Intergenic
988137682 5:27195986-27196008 GTACAAAGTTACAATTAGAAAGG - Intergenic
990126313 5:52522502-52522524 TTCCAAAATCACAAATATATGGG - Intergenic
990649021 5:57877522-57877544 ATACAAAAACAAAATTATCCAGG + Intergenic
991243711 5:64487416-64487438 GTACAAAATTACAGTTAGATAGG - Intergenic
991644222 5:68785365-68785387 GTACAAAATTACAATTAGATTGG + Intergenic
991895000 5:71386162-71386184 ATACAAAATTTCAATTATATAGG - Intergenic
992131821 5:73700516-73700538 GTACAAAGTTGCAATTATAGAGG + Intronic
992346780 5:75887317-75887339 GTTCAAAATCTCAGTTAAACAGG - Intergenic
992701397 5:79344774-79344796 ATACAAAAACACAATTAGCCAGG + Intergenic
993118130 5:83742179-83742201 GTACAAAGTTTCAGTTATACAGG - Intergenic
994077059 5:95665311-95665333 GTACAAAATTACAATTAGATAGG - Intronic
994491609 5:100452761-100452783 ATACAAAATTACAACTAGACAGG + Intergenic
995918939 5:117287474-117287496 GTATATAATCACAAATAAACAGG + Intergenic
996103788 5:119474106-119474128 TTAGAAAATCATAATTATACTGG - Intronic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
996270597 5:121599988-121600010 GTACAAAATTTCAGTTAGACAGG - Intergenic
996941830 5:129016233-129016255 ATACAAAAACAAAATTAGACGGG + Intronic
997229367 5:132231540-132231562 GTCCAAAATCAAAATGTTACCGG + Intronic
997605295 5:135171048-135171070 GTACAAAGTTACAATTAGAAAGG - Intronic
999522532 5:152365436-152365458 CTACAAAATGAGAATTCTACTGG + Intergenic
1004212957 6:13670637-13670659 ATACAAAAACAAAATTAGACGGG + Intronic
1004882271 6:20020768-20020790 GTACAAAGTTTCAATTATACAGG + Intergenic
1007691723 6:43706771-43706793 GTAAAAAATCACAATAATGAGGG - Intergenic
1008184091 6:48369192-48369214 GTACAAAATTTCAATTAGACAGG - Intergenic
1008396889 6:51019106-51019128 ATACAAAATGACATTTGTACAGG - Intergenic
1008790580 6:55226877-55226899 GTAAAGAATCACAATTAGCCGGG - Intronic
1009235327 6:61116419-61116441 ATACAAAAGCAAAAATATACTGG + Intergenic
1009438837 6:63651656-63651678 ATACAAAATCACAACTAGGCAGG - Intronic
1009617495 6:66029096-66029118 GTACAAAATTTCAGTTAGACAGG + Intergenic
1010871151 6:81042033-81042055 GTACAGAGTTACAATTAGACAGG + Intergenic
1011176613 6:84568393-84568415 GTGCAAAATCTCAACTAGACGGG + Intergenic
1011236675 6:85226374-85226396 GTATAAAGTTTCAATTATACAGG + Intergenic
1011330159 6:86195834-86195856 GTACAAAATTCCAGTTAAACAGG + Intergenic
1011439787 6:87375717-87375739 GTTCAAAATCATAATTATAAAGG - Intronic
1012645553 6:101675123-101675145 GTACAAAGTTACAATTAGAAAGG - Intronic
1012725271 6:102802944-102802966 TTTCAAAATGACAATTATGCTGG - Intergenic
1013315444 6:108937851-108937873 GTACAAAAACAAAATTAGCCAGG - Intronic
1014042637 6:116847629-116847651 GAATAAAGTCAAAATTATACAGG - Intergenic
1014574733 6:123056320-123056342 GTACAAAGTTTCAATTAGACAGG - Intronic
1015035349 6:128646617-128646639 GTACAAAATCACAGAAATAAGGG + Intergenic
1015689629 6:135907337-135907359 GTAGAAAGGCACAATTTTACTGG - Intronic
1016260821 6:142167994-142168016 GTGTAAAATCACATTTATAAAGG + Intronic
1016740319 6:147520969-147520991 GTATAAAATTTCAATTAGACAGG - Intronic
1017018402 6:150119940-150119962 ATACAAAATTTCAATTAGACAGG - Intergenic
1019265440 7:114444-114466 GTACAGAATCACAAATCAACAGG - Intergenic
1021504506 7:21366781-21366803 ATACAAATTCACAATTACAGAGG + Intergenic
1021773157 7:24025306-24025328 GTACAAAAGCAAAACTATTCAGG - Intergenic
1021814541 7:24434406-24434428 CAACATAACCACAATTATACTGG + Intergenic
1022625197 7:32028798-32028820 TTACAAAATCTCAGTTACACAGG - Intronic
1022751865 7:33236880-33236902 GTACAAAGTTTCAATTAGACTGG - Intronic
1022938919 7:35212215-35212237 GTATAAAATGAAAAATATACTGG - Intronic
1023554911 7:41411516-41411538 GTACAAAATTTCAGTTGTACAGG - Intergenic
1027401791 7:77816671-77816693 TTACAAAATCACAGTTAGATAGG - Intronic
1028208623 7:88045636-88045658 GTACAAAAGTCCAATTATACTGG - Intronic
1028533438 7:91864171-91864193 ATACAAAATTTCAATTAGACGGG + Intronic
1028668528 7:93373784-93373806 GTACAAAATTACAGTTAGATAGG + Intergenic
1028814077 7:95123960-95123982 GTACAGAATCAAAATTTTAGAGG + Intronic
1028911277 7:96210193-96210215 GTAAAAAATCAGGATTATGCTGG + Intronic
1030232130 7:107219712-107219734 GTACAAAGTTACAGTTAGACAGG + Intronic
1032652844 7:133897379-133897401 GTACTAAATAATAATTATAATGG + Intronic
1033796974 7:144856841-144856863 GTATAAAATAACAATTCTAAGGG + Intergenic
1034519684 7:151610206-151610228 ATACAAAACCAAAATTATCCGGG + Intronic
1037169020 8:15867589-15867611 GTGCGAAGTCACAATTATAAAGG + Intergenic
1037308733 8:17532440-17532462 GTACAAAAGGACAAGTAAACTGG - Intronic
1038155716 8:24988305-24988327 TTACAAAATGAAAATTATAGTGG - Intergenic
1040742579 8:50597016-50597038 GTACAAAGTTACAGTTACACAGG - Intronic
1041444745 8:57938705-57938727 GTTTAAAATCAGAATTATATGGG - Intergenic
1041486331 8:58381536-58381558 GTACAAAATCTCAGTTAAACAGG - Intergenic
1041952640 8:63521254-63521276 GTACAAATTCACAATAAAAATGG + Intergenic
1042294451 8:67204200-67204222 GGACAAAAGCATAATTATAATGG - Intronic
1042803720 8:72748959-72748981 GTACAAAATTTCAGTTAGACGGG - Intronic
1043094538 8:75949722-75949744 GTACAAAGTTACATTTAAACAGG + Intergenic
1043197062 8:77308492-77308514 ATACAAAATTACAATCAGACAGG + Intergenic
1043736866 8:83759008-83759030 GTACAAAGTTACAATTAAATAGG + Intergenic
1044435411 8:92156541-92156563 ATGCAAAATAACAATTAGACAGG + Intergenic
1044831498 8:96254378-96254400 GTACAAAGTTTCAATTAGACAGG - Intronic
1044974717 8:97652713-97652735 ATAAAAAAACACAATTCTACTGG - Intronic
1045723896 8:105148323-105148345 GTACAAAATTTCAGTTAAACAGG - Intronic
1046062469 8:109155913-109155935 GTACAAATTCATTATTATCCAGG + Intergenic
1047070792 8:121341176-121341198 GTAGAAAATTTCAGTTATACAGG - Intergenic
1047151600 8:122270138-122270160 CTACAAAATTTCAATTATACTGG + Intergenic
1048025329 8:130581652-130581674 ATAAAAAATCACAAATATATAGG - Intergenic
1048515167 8:135101423-135101445 GTACAAAATTTCAGTTACACAGG - Intergenic
1049089586 8:140504428-140504450 TTATAAAATCAAAAGTATACAGG - Intergenic
1050961335 9:11736974-11736996 GTAGAAAATGACAACTATATTGG + Intergenic
1051201079 9:14624686-14624708 GTACAAAGTTACAATTAGAAAGG + Intronic
1051514754 9:17916356-17916378 GAACAAAATCACAATTGTCCAGG - Intergenic
1051864938 9:21669460-21669482 GTACAAAATTTCAGTTATATTGG - Intergenic
1052420057 9:28232718-28232740 GTACAAAGTTTCAATTAAACAGG - Intronic
1054194199 9:62014287-62014309 ATACAAAAACAAAATTAGACGGG + Intergenic
1054644208 9:67574404-67574426 ATACAAAAACAAAATTAGACGGG - Intergenic
1055398603 9:75899491-75899513 GTACAAACTCACAGTTATGTAGG - Intronic
1057462580 9:95276751-95276773 GTACAAAGTTACAGTTAGACAGG + Intronic
1058077452 9:100665399-100665421 GTACAAAATTACAATTAGAAAGG - Intergenic
1058366353 9:104213767-104213789 GTACAAAATTTCAGTTCTACAGG - Intergenic
1059509541 9:114831312-114831334 GTACAAAGTTACAATTAGATAGG - Intergenic
1059979435 9:119753744-119753766 GTATAAAATTTCCATTATACAGG - Intergenic
1185965937 X:4602801-4602823 GTACGAAGTTACAATTAGACAGG - Intergenic
1186234275 X:7490407-7490429 ATACAAAATGTCAATTAGACAGG + Intergenic
1186372089 X:8957285-8957307 GTACACAATCTAATTTATACAGG - Intergenic
1186934761 X:14436284-14436306 GTACAAAGTTACAATTAGATAGG - Intergenic
1187720757 X:22148586-22148608 GCACAAAATTTCAATTAGACTGG - Intronic
1188358144 X:29218234-29218256 TTACAAAATAAAAATTATACCGG - Intronic
1188602594 X:31987397-31987419 GTACAAAGTCACGATTAGAAAGG - Intronic
1188959389 X:36471408-36471430 ATACAAAATTTCACTTATACAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190574602 X:51820859-51820881 GTACAAAATTACAGTTAAATAGG - Intronic
1190773737 X:53536253-53536275 CTAGAAAAACACAATTATACAGG + Intronic
1190905930 X:54728215-54728237 GTACAAATTTACAGTTAGACAGG + Intergenic
1190949701 X:55131207-55131229 GTACAAAGCCTCAATTAGACAGG + Intronic
1191023739 X:55890804-55890826 AGACAAATCCACAATTATACTGG - Intergenic
1193623128 X:83781785-83781807 GTACAAAGTTACAATTAGAAAGG + Intergenic
1193664121 X:84295262-84295284 ATACAAAATTACAGTTATATAGG - Intergenic
1195980368 X:110570790-110570812 GTACAAAGCCCCAATTAGACAGG + Intergenic
1197308278 X:124871102-124871124 GTACAAAGTTACAATTAAATAGG - Intronic
1197476789 X:126934709-126934731 GTACAAAATTTCAGTTAGACTGG + Intergenic
1197863045 X:130990499-130990521 GTACAAAGTTTCAATTAGACAGG + Intergenic
1198326075 X:135574527-135574549 GTAAATAGTCACAATTATCCTGG - Intronic
1198789788 X:140331912-140331934 GTACAAAATTTCAGTTAAACAGG - Intergenic
1198819371 X:140630416-140630438 GTACAAAGTTTCAATTATTCAGG - Intergenic
1199066087 X:143420083-143420105 GTACAAAGTTACAATTATGTAGG - Intergenic
1199653815 X:149974920-149974942 GTATAAAATCACTATTATTTGGG - Intergenic
1200177782 X:154129387-154129409 GTACAAAATAACAATTAGATGGG + Intergenic
1201250393 Y:12052095-12052117 GTACAAAGTTTCAATTAGACAGG - Intergenic
1201327165 Y:12774303-12774325 ATACAAAAACAAAATTATCCGGG + Intronic
1202084445 Y:21121414-21121436 GTACAAATACAAAATTACACAGG - Intergenic