ID: 942519763

View in Genome Browser
Species Human (GRCh38)
Location 2:176791119-176791141
Sequence ATCATGGCTTCAACTCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942519752_942519763 26 Left 942519752 2:176791070-176791092 CCACCAGGTGATAACCCAGTCCA No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data
942519751_942519763 27 Left 942519751 2:176791069-176791091 CCCACCAGGTGATAACCCAGTCC No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data
942519760_942519763 6 Left 942519760 2:176791090-176791112 CCAGGGGATCAGTTGCAGATGGA No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data
942519758_942519763 11 Left 942519758 2:176791085-176791107 CCAGTCCAGGGGATCAGTTGCAG No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data
942519757_942519763 12 Left 942519757 2:176791084-176791106 CCCAGTCCAGGGGATCAGTTGCA No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data
942519754_942519763 23 Left 942519754 2:176791073-176791095 CCAGGTGATAACCCAGTCCAGGG No data
Right 942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942519763 Original CRISPR ATCATGGCTTCAACTCTCCA TGG Intergenic
No off target data available for this crispr