ID: 942534398

View in Genome Browser
Species Human (GRCh38)
Location 2:176948282-176948304
Sequence GAGGAGTCACATACTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942534398_942534400 -7 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534400 2:176948298-176948320 ACTCCTCAGCTTCTGACTAATGG No data
942534398_942534405 2 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534405 2:176948307-176948329 CTTCTGACTAATGGGGTACAGGG No data
942534398_942534404 1 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534404 2:176948306-176948328 GCTTCTGACTAATGGGGTACAGG No data
942534398_942534406 3 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534406 2:176948308-176948330 TTCTGACTAATGGGGTACAGGGG No data
942534398_942534402 -5 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534402 2:176948300-176948322 TCCTCAGCTTCTGACTAATGGGG No data
942534398_942534407 22 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534407 2:176948327-176948349 GGGGATGCTACCACAAAATATGG No data
942534398_942534408 30 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534408 2:176948335-176948357 TACCACAAAATATGGCAGCTTGG No data
942534398_942534401 -6 Left 942534398 2:176948282-176948304 CCTACCACAGTATGTGACTCCTC No data
Right 942534401 2:176948299-176948321 CTCCTCAGCTTCTGACTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942534398 Original CRISPR GAGGAGTCACATACTGTGGT AGG (reversed) Intergenic