ID: 942550542

View in Genome Browser
Species Human (GRCh38)
Location 2:177111709-177111731
Sequence CAGAGTCTTCAGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942550542_942550552 30 Left 942550542 2:177111709-177111731 CCTCCATCCATCTGAAGACTCTG No data
Right 942550552 2:177111762-177111784 TCTGTATTCAGCTAACATTAGGG No data
942550542_942550551 29 Left 942550542 2:177111709-177111731 CCTCCATCCATCTGAAGACTCTG No data
Right 942550551 2:177111761-177111783 GTCTGTATTCAGCTAACATTAGG No data
942550542_942550545 -4 Left 942550542 2:177111709-177111731 CCTCCATCCATCTGAAGACTCTG No data
Right 942550545 2:177111728-177111750 TCTGCCATCCTCTGAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942550542 Original CRISPR CAGAGTCTTCAGATGGATGG AGG (reversed) Intergenic
No off target data available for this crispr