ID: 942552805

View in Genome Browser
Species Human (GRCh38)
Location 2:177137362-177137384
Sequence CAGAAGATGGGGAAAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942552805_942552814 -8 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552814 2:177137377-177137399 ATCTTCTGGGTTCTTCCTCTAGG No data
942552805_942552815 -7 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552815 2:177137378-177137400 TCTTCTGGGTTCTTCCTCTAGGG No data
942552805_942552816 -6 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552816 2:177137379-177137401 CTTCTGGGTTCTTCCTCTAGGGG No data
942552805_942552819 18 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552819 2:177137403-177137425 GTCCAATCTTTTGGCTTCCCTGG 0: 680
1: 1004
2: 719
3: 347
4: 250
942552805_942552818 9 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552818 2:177137394-177137416 TCTAGGGGTGTCCAATCTTTTGG No data
942552805_942552820 19 Left 942552805 2:177137362-177137384 CCAGCCCCTTTCCCCATCTTCTG No data
Right 942552820 2:177137404-177137426 TCCAATCTTTTGGCTTCCCTGGG 0: 728
1: 1007
2: 643
3: 334
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942552805 Original CRISPR CAGAAGATGGGGAAAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr