ID: 942554744 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:177160191-177160213 |
Sequence | CATCAAAGGGAGATCATGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942554738_942554744 | 10 | Left | 942554738 | 2:177160158-177160180 | CCATCTTATCTCTAAATCTACAT | No data | ||
Right | 942554744 | 2:177160191-177160213 | CATCAAAGGGAGATCATGGTGGG | No data | ||||
942554737_942554744 | 20 | Left | 942554737 | 2:177160148-177160170 | CCTAAACTTTCCATCTTATCTCT | No data | ||
Right | 942554744 | 2:177160191-177160213 | CATCAAAGGGAGATCATGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942554744 | Original CRISPR | CATCAAAGGGAGATCATGGT GGG | Intergenic | ||
No off target data available for this crispr |