ID: 942554744

View in Genome Browser
Species Human (GRCh38)
Location 2:177160191-177160213
Sequence CATCAAAGGGAGATCATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942554738_942554744 10 Left 942554738 2:177160158-177160180 CCATCTTATCTCTAAATCTACAT No data
Right 942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG No data
942554737_942554744 20 Left 942554737 2:177160148-177160170 CCTAAACTTTCCATCTTATCTCT No data
Right 942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942554744 Original CRISPR CATCAAAGGGAGATCATGGT GGG Intergenic
No off target data available for this crispr